Download or read book Was Life Created written by Watch Tower Bible and Tract Society of Pennsylvania and published by . This book was released on 2010 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Creation Facts of Life written by Gary Parker and published by New Leaf Publishing Group. This book was released on 2006-08 with total page 242 pages. Available in PDF, EPUB and Kindle. Book excerpt: In Creation Facts of Life, Dr. Parker respectfully describes the evidences he once used to "preach" evolution - but then he explains how the "rest of the evidence" points away from evolution and toward a perfect world created by God, ruined by man, restored to new life in Christ!
Download or read book Science and Creationism written by National Academy of Sciences (U.S.) and published by National Academies Press. This book was released on 1999 with total page 48 pages. Available in PDF, EPUB and Kindle. Book excerpt: This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)
Download or read book The Origins of Life written by Hoimar von Ditfurth and published by HarperCollins Publishers. This book was released on 1982 with total page 312 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Biocentrism written by Robert Lanza and published by ReadHowYouWant.com. This book was released on 2011 with total page 298 pages. Available in PDF, EPUB and Kindle. Book excerpt: Robert Lanza is one of the most respected scientists in the world a US News and World Report cover story called him a genius and a renegade thinker, even likening him to Einstein. Lanza has teamed with Bob Berman, the most widely read astronomer in the world, to produce Biocentrism, a revolutionary new view of the universe. Every now and then a simple yet radical idea shakes the very foundations of knowledge. The startling discovery that the world was not flat challenged and ultimately changed the way people perceived themselves and their relationship with the world. For most humans of the 15th century, the notion of Earth as ball of rock was nonsense. The whole of Western, natural philosophy is undergoing a sea change again, increasingly being forced upon us by the experimental findings of quantum theory, and at the same time, toward doubt and uncertainty in the physical explanations of the universes genesis and structure. Biocentrism completes this shift in worldview, turning the planet upside down again with the revolutionary view that life creates the universe instead of the other way around. In this paradigm, life is not an accidental byproduct of the laws of physics. Biocentrism takes the reader on a seemingly improbable but ultimately inescapable journey through a foreign universe our own from the viewpoints of an acclaimed biologist and a leading astronomer. Switching perspective from physics to biology unlocks the cages in which Western science has unwittingly managed to confine itself. Biocentrism will shatter the readers ideas of life--time and space, and even death. At the same time it will release us from the dull worldview of life being merely the activity of an admixture of carbon and a few other elements; it suggests the exhilarating possibility that life is fundamentally immortal. The 21st century is predicted to be the Century of Biology, a shift from the previous century dominated by physics. It seems fitting, then, to begin the century by turning the universe outside-in and unifying the foundations of science with a simple idea discovered by one of the leading life-scientists of our age. Biocentrism awakens in readers a new sense of possibility, and is full of so many shocking new perspectives that the reader will never see reality the same way again.
Download or read book Perfect Planet Clever Species written by William C. Burger and published by Prometheus Books. This book was released on 2011-04-29 with total page 345 pages. Available in PDF, EPUB and Kindle. Book excerpt: [A] masterful survey. - Times Literary Supplement[A] concise ... extremely well-written journey about this planet''s history.... Highly recommended. - ChoiceIn a feat that may rival time travel, Burger has condensed 4.5 billion years into 294 eminently readable pages as he builds a case for solitude in our Milky Way galaxy. [Burger] writes with the clarity and humor of one who has had experience communicating complicated ideas to the lay public.-Boston GlobeFor many years the federal government funded the Search for Extraterrestrial Intelligence (SETI), later popularized by Carl Sagan''s novel Contact and the movie starring Jodie Foster. Though in actuality SETI never did make contact with signals from an alien civilization, the search continues to this day through privately funded endeavors. How likely is it that intelligent life exists elsewhere in the universe? This is the intriguing question that has prompted William Burger''s illuminating and absorbing exploration of the unusual circumstances surrounding life on earth.Examining the critical episodes in our planet''s early history and the peculiar trajectory of life on our world, Burger shows that the long odyssey of planet Earth may be utterly unique in our galaxy. For example, he describes features of the sun that are far from average. By some estimates, 95 percent of the other stars in the Milky Way galaxy are smaller, and it is unlikely that any of them could supply the energy requirements for a life-sustaining planet such as our own. Earth, as the third planet from the sun, sits within the Goldilocks orbit: it is in the perfect position to receive not too much heat (like Mercury and Venus) and not too little (like more distant planets of the solar system) but just the right amount to foster the development of life.Turning to the evolution of life itself, Burger points out a host of amazing accidents (for example, the extinction of dinosaurs and the proliferation of flowering plants) that make the steps along the way to Homo sapiens seem like very rare events indeed. He also calls attention to the curious fact that the early hominid brain tripled in size over the relatively short time period leading to the appearance of modern human beings. Finally, he notes aspects of humanity''s cultural evolution that seem unlikely to have been duplicated anywhere else.Burger''s enlightening evaluation of evolutionary and cosmic history, full of fascinating details, shows that the human achievement may be unique in our galaxy.More Praise for Perfect Planet, Clever Species:This is by far the best existing treatment of the SETI problem. Based on the most recent findings of science, it analyzes in full detail all the unique factors that would have to be right for success. Particularly fascinating is Burger''s critical study of the ten thousands of unpredictable steps in the evolution of Homo sapiens after the origin of life. A splendid history of mankind. - Ernst Mayr, Harvard UniversityI believe that this brilliant, richly documented and well-written book, on par in historical influence (or importance) with classics such as Rachel Carson''s Silent Spring, Paul Ehrlich''s The Population Bomb, E.O. Wilson''s On Human Nature or Sarah Blaffer''s Mother Nature, will go down as one of the most significant philosophical guides for us to follow as we stumble blindly into the 21st Century. - Hugh H. Iltis, Emeritus Botany Professor, University of Wisconsin-MadisonWith a lively narrative and at a headlong pace, Bill Burger leads us expertly from the origin of our planet through to the evolutionary history of humankind. Along the way, he repeatedly highlights the part played by chance occurrence of favourable conditions. Such contingency means that we can reconstruct our past but not predict our future. But we can address Burger''s central question: ''Are we alone?'' Soberingly, he builds up step-by-step to his conclusion.... The history of evolution on Earth is a compelling story in its own right and one tha
Download or read book The Book that Made Your World written by Vishal Mangalwadi and published by Thomas Nelson. This book was released on 2012-10-24 with total page 466 pages. Available in PDF, EPUB and Kindle. Book excerpt: Understand where we came from. Whether you're an avid student of the Bible or a skeptic of its relevance, The Book That Made Your World will transform your perception of its influence on virtually every facet of Western civilization. Indian philosopher Vishal Mangalwadi reveals the personal motivation that fueled his own study of the Bible and systematically illustrates how its precepts became the framework for societal structure throughout the last millennium. From politics and science, to academia and technology, the Bible's sacred copy became the key that unlocked the Western mind. Through Mangalwadi's wide-ranging and fascinating investigation, you'll discover: What triggered the West's passion for scientific, medical, and technological advancement How the biblical notion of human dignity informs the West's social structure and how it intersects with other worldviews How the Bible created a fertile ground for women to find social and economic empowerment How the Bible has uniquely equipped the West to cultivate compassion, human rights, prosperity, and strong families The role of the Bible in the transformation of education How the modern literary notion of a hero has been shaped by the Bible's archetypal protagonist Journey with Mangalwadi as he examines the origins of a civilization's greatness and the misguided beliefs that threaten to unravel its progress. Learn how the Bible transformed the social, political, and religious institutions that have sustained Western culture for the past millennium, and discover how secular corruption endangers the stability and longevity of Western civilization. Endorsements: “This is an extremely significant piece of work with huge global implications. Vishal brings a timely message.” (Ravi Zacharias, author, Walking from East to West and Beyond Opinion) “In polite society, the mere mention of the Bible often introduces a certain measure of anxiety. A serious discussion on the Bible can bring outright contempt. Therefore, it is most refreshing to encounter this engaging and informed assessment of the Bible’s profound impact on the modern world. Where Bloom laments the closing of the American mind, Mangalwadi brings a refreshing optimism.” (Stanley Mattson, founder and president, C. S. Lewis Foundation) “Vishal Mangalwadi recounts history in very broad strokes, always using his cross-cultural perspectives for highlighting the many benefits of biblical principles in shaping civilization.” (George Marsden, professor, University of Notre Dame; author, Fundamentalism and American Culture)
Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Download or read book God Created the Sea Life of the World written by Earl Snellenberger and published by Master Books. This book was released on 1989 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Contains pictures of various marine fishes with a short description of each.
Download or read book Home Sweet Anywhere written by Lynne Martin and published by Sourcebooks, Inc.. This book was released on 2014-04-15 with total page 264 pages. Available in PDF, EPUB and Kindle. Book excerpt: "Nearly every page has some crack piece of travel wisdom ... an accessible, inspiring journey." —Kirkus The Sell-Your-House, See-the-World Life! Reunited after thirty-five years and wrestling a serious case of wanderlust, Lynne and Tim Martin decided to sell their house and possessions and live abroad full-time. They've never looked back. With just two suitcases, two computers, and each other, the Martins embark on a global adventure, taking readers from sky-high pyramids in Mexico to Turkish bazaars to learning the contact sport of Italian grocery shopping. But even as they embrace their new home-free lifestyle, the Martins grapple with its challenges, including hilarious language barriers, finding financial stability, and missing the family they left behind. Together, they learn how to live a life—and love—without borders. Recently featured on NPR's Here and Now and in the New York Times, Home Sweet Anywhere is a road map for anyone who dreams of turning the idea of life abroad into a reality.
Download or read book The 100 Year Life written by Lynda Gratton and published by Bloomsbury Publishing. This book was released on 2020-05-28 with total page 299 pages. Available in PDF, EPUB and Kindle. Book excerpt: What will your 100-year life look like? A new edition of the international bestseller, featuring a new preface 'Brilliant, timely, original, well written and utterly terrifying' Niall Ferguson Does the thought of working for 60 or 70 years fill you with dread? Or can you see the potential for a more stimulating future as a result of having so much extra time? Many of us have been raised on the traditional notion of a three-stage approach to our working lives: education, followed by work and then retirement. But this well-established pathway is already beginning to collapse – life expectancy is rising, final-salary pensions are vanishing, and increasing numbers of people are juggling multiple careers. Whether you are 18, 45 or 60, you will need to do things very differently from previous generations and learn to structure your life in completely new ways. The 100-Year Life is here to help. Drawing on the unique pairing of their experience in psychology and economics, Lynda Gratton and Andrew J. Scott offer a broad-ranging analysis as well as a raft of solutions, showing how to rethink your finances, your education, your career and your relationships and create a fulfilling 100-year life. · How can you fashion a career and life path that defines you and your values and creates a shifting balance between work and leisure? · What are the most effective ways of boosting your physical and mental health over a longer and more dynamic lifespan? · How can you make the most of your intangible assets – such as family and friends – as you build a productive, longer life? · In a multiple-stage life how can you learn to make the transitions that will be so crucial and experiment with new ways of living, working and learning? Shortlisted for the FT/McKinsey Business Book of the Year Award and featuring a new preface, The 100-Year Life is a wake-up call that describes what to expect and considers the choices and options that you will face. It is also fundamentally a call to action for individuals, politicians, firms and governments and offers the clearest demonstration that a 100-year life can be a wonderful and inspiring one.
Download or read book The First Book of Moses Called Genesis written by and published by Grove/Atlantic, Inc.. This book was released on 1999 with total page 146 pages. Available in PDF, EPUB and Kindle. Book excerpt: Hailed as "the most radical repackaging of the Bible since Gutenberg", these Pocket Canons give an up-close look at each book of the Bible.
Download or read book The Popol Vuh written by Lewis Spence and published by New York : AMS Press. This book was released on 1908 with total page 80 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book School of the Supernatural written by Ryan Wyatt and published by Destiny Image Publishers. This book was released on 2011-04-19 with total page 121 pages. Available in PDF, EPUB and Kindle. Book excerpt: Your spiritual glass is half empty if your Christian life consists only of good theology, good works, and just attending church without a truly supernatural lifestyle. Many believers, even those who are Spirit-filled, cannot claim to possess a fully supernatural life. Happy with an occasional taste of Heaven, they assume that such a goal is out of reach. In this well written and easy to understand manual, author Ryan Wyatt explains the interplay of the physical and spiritual worlds in a fresh way that shows you—beyond doubt—that a supernatural lifestyle is available to you as well.
Download or read book Micrographia written by Robert Hooke and published by . This book was released on 1665 with total page 394 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Created for His Glory written by Jim Berg and published by . This book was released on 2002 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Despair is epidemic today, even among many believers. Why do the peace and joy that the Bible describes seem like an impossible dream? In this sequel to his popular book Changed Into His Image, Jim Berg paints an exhilarating picture of the contentment that comes from seeing God's purpose for redeeming your life. See how being aware of God's purpose for your life can lead you or someone else to restoration. Study the same truths that thrilled the hearts of first-century saints as they lived and suffered for Christ in a pagan, affluent culture -- truths that will replace despair with unspeakable joy. - Back cover.
Download or read book The Immortal Life of Henrietta Lacks written by Rebecca Skloot and published by Crown. This book was released on 2010-02-02 with total page 386 pages. Available in PDF, EPUB and Kindle. Book excerpt: #1 NEW YORK TIMES BESTSELLER • “The story of modern medicine and bioethics—and, indeed, race relations—is refracted beautifully, and movingly.”—Entertainment Weekly NOW A MAJOR MOTION PICTURE FROM HBO® STARRING OPRAH WINFREY AND ROSE BYRNE • ONE OF THE “MOST INFLUENTIAL” (CNN), “DEFINING” (LITHUB), AND “BEST” (THE PHILADELPHIA INQUIRER) BOOKS OF THE DECADE • ONE OF ESSENCE’S 50 MOST IMPACTFUL BLACK BOOKS OF THE PAST 50 YEARS • WINNER OF THE CHICAGO TRIBUNE HEARTLAND PRIZE FOR NONFICTION NAMED ONE OF THE BEST BOOKS OF THE YEAR BY The New York Times Book Review • Entertainment Weekly • O: The Oprah Magazine • NPR • Financial Times • New York • Independent (U.K.) • Times (U.K.) • Publishers Weekly • Library Journal • Kirkus Reviews • Booklist • Globe and Mail Her name was Henrietta Lacks, but scientists know her as HeLa. She was a poor Southern tobacco farmer who worked the same land as her slave ancestors, yet her cells—taken without her knowledge—became one of the most important tools in medicine: The first “immortal” human cells grown in culture, which are still alive today, though she has been dead for more than sixty years. HeLa cells were vital for developing the polio vaccine; uncovered secrets of cancer, viruses, and the atom bomb’s effects; helped lead to important advances like in vitro fertilization, cloning, and gene mapping; and have been bought and sold by the billions. Yet Henrietta Lacks remains virtually unknown, buried in an unmarked grave. Henrietta’s family did not learn of her “immortality” until more than twenty years after her death, when scientists investigating HeLa began using her husband and children in research without informed consent. And though the cells had launched a multimillion-dollar industry that sells human biological materials, her family never saw any of the profits. As Rebecca Skloot so brilliantly shows, the story of the Lacks family—past and present—is inextricably connected to the dark history of experimentation on African Americans, the birth of bioethics, and the legal battles over whether we control the stuff we are made of. Over the decade it took to uncover this story, Rebecca became enmeshed in the lives of the Lacks family—especially Henrietta’s daughter Deborah. Deborah was consumed with questions: Had scientists cloned her mother? Had they killed her to harvest her cells? And if her mother was so important to medicine, why couldn’t her children afford health insurance? Intimate in feeling, astonishing in scope, and impossible to put down, The Immortal Life of Henrietta Lacks captures the beauty and drama of scientific discovery, as well as its human consequences.