Download or read book The Gene Book written by Sarah Adelaide Crawford and published by Cognella Academic Publishing. This book was released on 2018-06-28 with total page pages. Available in PDF, EPUB and Kindle. Book excerpt: The Gene Book: Explorations in the Code of Life is designed to introduce undergraduate college students to foundational concepts in genetics. The text provides in-depth coverage of the essential principles of genetics, from Mendel to molecular gene therapy, and reads like a story, guiding readers through each of these areas in an interesting, engaging, and enlightening way. Milestone scientific discoveries introduce conceptual topics in each of the 10 chapters. The significance of each genetics paradigm is reinforced by the meaningful research context in which it is placed, whether the focus is single gene inheritance of disorders such as PKU and cystic fibrosis, or more complex genetic phenomena. Chromosomes, cell division, and cytogenetic disorders, including Down Syndrome and leukemia, are presented in a riveting historical context. In addition, the principles of molecular genetics are a major focus of this book. Students learn about the double helix, DNA replication, gene expression, mutation, natural selection, genomics, and the tools of molecular DNA analysis. Approachable and effective, The Gene Book is a highly readable comprehensive text on genetics principles designed to highlight essential concepts that make up their very core. The text is well suited to undergraduate genetics courses and can also be used as a primer for more advanced undergraduate and graduate courses in medical or molecular genetics.

Download or read book The Gene Book Explorations in the Code of Life written by Sarah Adelaide Crawford and published by . This book was released on 2017-12-31 with total page 138 pages. Available in PDF, EPUB and Kindle. Book excerpt: The Gene Book: Explorations in the Code of Life is designed to introduce undergraduate college students to foundational concepts in genetics. The text provides in-depth coverage of the essential principles of genetics, from Mendel to molecular gene therapy, and reads like a story, guiding readers through each of these areas in an interesting, engaging, and enlightening way. Milestone scientific discoveries introduce conceptual topics in each of the 10 chapters. The significance of each genetics paradigm is reinforced by the meaningful research context in which it is placed, whether the focus is single gene inheritance of disorders such as PKU and cystic fibrosis, or more complex genetic phenomena. Chromosomes, cell division, and cytogenetic disorders, including Down Syndrome and leukemia, are presented in a riveting historical context. In addition, the principles of molecular genetics are a major focus of this book. Students learn about the double helix, DNA replication, gene expression, mutation, natural selection, genomics, and the tools of molecular DNA analysis. Approachable and effective, The Gene Book is a highly readable comprehensive text on genetics principles designed to highlight essential concepts that make up their very core. The text is well suited to undergraduate genetics courses and can also be used as a primer for more advanced undergraduate and graduate courses in medial or molecular genetics. Sarah Adelaide Crawford is professor of genetics at Southern Connecticut State University. Dr. Crawford received a Ph.D. from Columbia University College of Physicians and Surgeons, an M.S. degree in biochemistry from Princeton University, and a B.S. degree from Marymount Manhattan College. She is director of the Cancer Biology Research Laboratory and the recently opened the Autism Research Laboratory at the Southern Connecticut State University.

Download or read book Hacking the Code of Life written by Nessa Carey and published by Icon Books. This book was released on 2019-03-07 with total page 112 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'An excellent, brisk guide to what is likely to happen as opposed to the fantastically remote.' - Los Angeles Review of Books In 2018 the world woke up to gene editing with a storm of controversy over twin girls born in China with genetic changes deliberately introduced by scientists - changes they will pass on to their own offspring. Genetic modification (GM) has been with us for 45 years now, but the new system known as CRISPR or gene editing can manipulate the genes of almost any organism with a degree of precision, ease and speed that we could only dream of ten years ago. But is it ethical to change the genetic material of organisms in a way that might be passed on to future generations? If a person is suffering from a lethal genetic disease, is it unethical to deny them this option? Who controls the application of this technology, when it makes 'biohacking' - perhaps of one's own genome - a real possibility? Nessa Carey's book is a thrilling and timely snapshot of a cutting-edge technology that will radically alter our futures and the way we prevent disease. 'A focused snapshot of a brave new world.' - Nature 'A brisk, accessible primer on the fast-moving field, a clear-eyed look at a technology that is already driving major scientific advances - and raising complex ethical questions.' - Emily Anthes, Undark

Download or read book Above the Gene Beyond Biology written by Jan Baedke and published by University of Pittsburgh Press. This book was released on 2018-05-23 with total page 259 pages. Available in PDF, EPUB and Kindle. Book excerpt: Epigenetics is currently one of the fastest-growing fields in the sciences. Epigenetic information not only controls DNA expression but links genetic factors with the environmental experiences that influence the traits and characteristics of an individual. What we eat, where we work, and how we live affects not only the activity of our genes but that of our offspring as well. This discovery has imposed a revolutionary theoretical shift on modern biology, especially on evolutionary theory. It has helped to uncover the developmental processes leading to cancer, obesity, schizophrenia, alcoholism, and aging, and to facilitate associated medial applications such as stem cell therapy and cloning. Above the Gene, Beyond Biology explores how biologists in this booming field investigate and explain living systems. Jan Baedke offers the first comprehensive philosophical discussion of epigenetic concepts, explanations, and methodologies so that we can better understand this “epigenetic turn” in the life sciences from a philosophical perspective.

Download or read book The Gene written by Siddhartha Mukherjee and published by Simon and Schuster. This book was released on 2016-05-17 with total page 624 pages. Available in PDF, EPUB and Kindle. Book excerpt: The #1 NEW YORK TIMES Bestseller The basis for the PBS Ken Burns Documentary The Gene: An Intimate History Now includes an excerpt from Siddhartha Mukherjee’s new book Song of the Cell! From the Pulitzer Prize–winning author of The Emperor of All Maladies—a fascinating history of the gene and “a magisterial account of how human minds have laboriously, ingeniously picked apart what makes us tick” (Elle). “Sid Mukherjee has the uncanny ability to bring together science, history, and the future in a way that is understandable and riveting, guiding us through both time and the mystery of life itself.” —Ken Burns “Dr. Siddhartha Mukherjee dazzled readers with his Pulitzer Prize-winning The Emperor of All Maladies in 2010. That achievement was evidently just a warm-up for his virtuoso performance in The Gene: An Intimate History, in which he braids science, history, and memoir into an epic with all the range and biblical thunder of Paradise Lost” (The New York Times). In this biography Mukherjee brings to life the quest to understand human heredity and its surprising influence on our lives, personalities, identities, fates, and choices. “Mukherjee expresses abstract intellectual ideas through emotional stories…[and] swaddles his medical rigor with rhapsodic tenderness, surprising vulnerability, and occasional flashes of pure poetry” (The Washington Post). Throughout, the story of Mukherjee’s own family—with its tragic and bewildering history of mental illness—reminds us of the questions that hang over our ability to translate the science of genetics from the laboratory to the real world. In riveting and dramatic prose, he describes the centuries of research and experimentation—from Aristotle and Pythagoras to Mendel and Darwin, from Boveri and Morgan to Crick, Watson and Franklin, all the way through the revolutionary twenty-first century innovators who mapped the human genome. “A fascinating and often sobering history of how humans came to understand the roles of genes in making us who we are—and what our manipulation of those genes might mean for our future” (Milwaukee Journal-Sentinel), The Gene is the revelatory and magisterial history of a scientific idea coming to life, the most crucial science of our time, intimately explained by a master. “The Gene is a book we all should read” (USA TODAY).

Download or read book The Century of the Gene written by Evelyn Fox KELLER and published by Harvard University Press. This book was released on 2009-06-30 with total page 194 pages. Available in PDF, EPUB and Kindle. Book excerpt: In a book that promises to change the way we think and talk about genes and genetic determinism, Evelyn Fox Keller, one of our most gifted historians and philosophers of science, provides a powerful, profound analysis of the achievements of genetics and molecular biology in the twentieth century, the century of the gene. Not just a chronicle of biology’s progress from gene to genome in one hundred years, The Century of the Gene also calls our attention to the surprising ways these advances challenge the familiar picture of the gene most of us still entertain. Keller shows us that the very successes that have stirred our imagination have also radically undermined the primacy of the gene—word and object—as the core explanatory concept of heredity and development. She argues that we need a new vocabulary that includes concepts such as robustness, fidelity, and evolvability. But more than a new vocabulary, a new awareness is absolutely crucial: that understanding the components of a system (be they individual genes, proteins, or even molecules) may tell us little about the interactions among these components. With the Human Genome Project nearing its first and most publicized goal, biologists are coming to realize that they have reached not the end of biology but the beginning of a new era. Indeed, Keller predicts that in the new century we will witness another Cambrian era, this time in new forms of biological thought rather than in new forms of biological life.

Download or read book The Secret Life of Genes written by Derek Harvey and published by Cassell. This book was released on 2019-04-04 with total page 192 pages. Available in PDF, EPUB and Kindle. Book excerpt: Genes have a huge impact on who we are, from defining us as humans, to governing how we behave. Whether controlling our cells or creating new forms of life, discover how DNA makes each of us unique. In The Secret Life of Genes, you'll learn all about the past, present and future of the human genome. Filled with colourful, graphic illustrations to help you to understand the world of genetics, from the basics to the most complex theories, this book brings the inner workings of the human body to life. Derek Harvey answers the biggest questions, from the nature of inheritance, evolution and reproduction, to how genes are arranged and how DNA is read. Take a trip through the history of the world's DNA and unlock the future of the field.

Download or read book DNA written by James D. Watson and published by Knopf. This book was released on 2009-01-21 with total page 464 pages. Available in PDF, EPUB and Kindle. Book excerpt: Fifty years ago, James D. Watson, then just twentyfour, helped launch the greatest ongoing scientific quest of our time. Now, with unique authority and sweeping vision, he gives us the first full account of the genetic revolution—from Mendel’s garden to the double helix to the sequencing of the human genome and beyond. Watson’s lively, panoramic narrative begins with the fanciful speculations of the ancients as to why “like begets like” before skipping ahead to 1866, when an Austrian monk named Gregor Mendel first deduced the basic laws of inheritance. But genetics as we recognize it today—with its capacity, both thrilling and sobering, to manipulate the very essence of living things—came into being only with the rise of molecular investigations culminating in the breakthrough discovery of the structure of DNA, for which Watson shared a Nobel prize in 1962. In the DNA molecule’s graceful curves was the key to a whole new science. Having shown that the secret of life is chemical, modern genetics has set mankind off on a journey unimaginable just a few decades ago. Watson provides the general reader with clear explanations of molecular processes and emerging technologies. He shows us how DNA continues to alter our understanding of human origins, and of our identities as groups and as individuals. And with the insight of one who has remained close to every advance in research since the double helix, he reveals how genetics has unleashed a wealth of possibilities to alter the human condition—from genetically modified foods to genetically modified babies—and transformed itself from a domain of pure research into one of big business as well. It is a sometimes topsy-turvy world full of great minds and great egos, driven by ambitions to improve the human condition as well as to improve investment portfolios, a world vividly captured in these pages. Facing a future of choices and social and ethical implications of which we dare not remain uninformed, we could have no better guide than James Watson, who leads us with the same bravura storytelling that made The Double Helix one of the most successful books on science ever published. Infused with a scientist’s awe at nature’s marvels and a humanist’s profound sympathies, DNA is destined to become the classic telling of the defining scientific saga of our age.

Download or read book The Genetic Lottery written by Kathryn Paige Harden and published by Princeton University Press. This book was released on 2022-10-11 with total page 320 pages. Available in PDF, EPUB and Kindle. Book excerpt: A provocative and timely case for how the science of genetics can help create a more just and equal society In recent years, scientists like Kathryn Paige Harden have shown that DNA makes us different, in our personalities and in our health—and in ways that matter for educational and economic success in our current society. In The Genetic Lottery, Harden introduces readers to the latest genetic science, dismantling dangerous ideas about racial superiority and challenging us to grapple with what equality really means in a world where people are born different. Weaving together personal stories with scientific evidence, Harden shows why our refusal to recognize the power of DNA perpetuates the myth of meritocracy, and argues that we must acknowledge the role of genetic luck if we are ever to create a fair society. Reclaiming genetic science from the legacy of eugenics, this groundbreaking book offers a bold new vision of society where everyone thrives, regardless of how one fares in the genetic lottery.

Download or read book Genes in Conflict written by Austin BURT and published by Harvard University Press. This book was released on 2009-06-30 with total page 613 pages. Available in PDF, EPUB and Kindle. Book excerpt: Covering all species from yeast to humans, this is the first book to tell the story of selfish genetic elements that act narrowly to advance their own replication at the expense of the larger organism.

Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Download or read book Molecular Biology of The Cell written by Bruce Alberts and published by . This book was released on 2002 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt:

Download or read book The Selfish Gene written by Richard Dawkins and published by Oxford University Press, USA. This book was released on 1989 with total page 372 pages. Available in PDF, EPUB and Kindle. Book excerpt: Science need not be dull and bogged down by jargon, as Richard Dawkins proves in this entertaining look at evolution. The themes he takes up are the concepts of altruistic and selfish behaviour; the genetical definition of selfish interest; the evolution of aggressive behaviour; kinshiptheory; sex ratio theory; reciprocal altruism; deceit; and the natural selection of sex differences. 'Should be read, can be read by almost anyone. It describes with great skill a new face of the theory of evolution.' W.D. Hamilton, Science

Download or read book Mapping and Sequencing the Human Genome written by National Research Council and published by National Academies Press. This book was released on 1988-01-01 with total page 128 pages. Available in PDF, EPUB and Kindle. Book excerpt: There is growing enthusiasm in the scientific community about the prospect of mapping and sequencing the human genome, a monumental project that will have far-reaching consequences for medicine, biology, technology, and other fields. But how will such an effort be organized and funded? How will we develop the new technologies that are needed? What new legal, social, and ethical questions will be raised? Mapping and Sequencing the Human Genome is a blueprint for this proposed project. The authors offer a highly readable explanation of the technical aspects of genetic mapping and sequencing, and they recommend specific interim and long-range research goals, organizational strategies, and funding levels. They also outline some of the legal and social questions that might arise and urge their early consideration by policymakers.

Download or read book The Code Breaker written by Walter Isaacson and published by Simon and Schuster. This book was released on 2021-03-09 with total page 560 pages. Available in PDF, EPUB and Kindle. Book excerpt: A Best Book of 2021 by Bloomberg BusinessWeek, Time, and The Washington Post The bestselling author of Leonardo da Vinci and Steve Jobs returns with a “compelling” (The Washington Post) account of how Nobel Prize winner Jennifer Doudna and her colleagues launched a revolution that will allow us to cure diseases, fend off viruses, and have healthier babies. When Jennifer Doudna was in sixth grade, she came home one day to find that her dad had left a paperback titled The Double Helix on her bed. She put it aside, thinking it was one of those detective tales she loved. When she read it on a rainy Saturday, she discovered she was right, in a way. As she sped through the pages, she became enthralled by the intense drama behind the competition to discover the code of life. Even though her high school counselor told her girls didn’t become scientists, she decided she would. Driven by a passion to understand how nature works and to turn discoveries into inventions, she would help to make what the book’s author, James Watson, told her was the most important biological advance since his codiscovery of the structure of DNA. She and her collaborators turned a curiosity of nature into an invention that will transform the human race: an easy-to-use tool that can edit DNA. Known as CRISPR, it opened a brave new world of medical miracles and moral questions. The development of CRISPR and the race to create vaccines for coronavirus will hasten our transition to the next great innovation revolution. The past half-century has been a digital age, based on the microchip, computer, and internet. Now we are entering a life-science revolution. Children who study digital coding will be joined by those who study genetic code. Should we use our new evolution-hacking powers to make us less susceptible to viruses? What a wonderful boon that would be! And what about preventing depression? Hmmm…Should we allow parents, if they can afford it, to enhance the height or muscles or IQ of their kids? After helping to discover CRISPR, Doudna became a leader in wrestling with these moral issues and, with her collaborator Emmanuelle Charpentier, won the Nobel Prize in 2020. Her story is an “enthralling detective story” (Oprah Daily) that involves the most profound wonders of nature, from the origins of life to the future of our species.

Download or read book Revolutionary Biology written by David Barash and published by Routledge. This book was released on 2017-07-05 with total page 222 pages. Available in PDF, EPUB and Kindle. Book excerpt: There is a revolution underway in biology. It is based on a new perception of bodies and genes, in which the former are the end product of the latter within the continuum of evolution. Twenty fi ve years after Richard Dawkins helped revolutionize our thinking about "selfi sh genes," it is time to reevaluate. Revolutionary Biology explains in simple, vivid terms what this exciting approach has to off er, and then applies its stunning insights to human beings. Th is novel perspective, galvanizes our understanding of how evolution works, what living things are all about and, not least, what it means to be human. Th e controversial disciplines of sociobiology and evolutionary psychology have generated startling insights into longstanding questions concerning the nature and purpose of families, altruism vs. selfi shness, and free will vs. biological determinism. Written by one of its foremost fi gures, Revolutionary Biology is a manifesto and educated layman's guide to this ongoing revolution.

Download or read book The Music of Life written by Denis Noble and published by Oxford University Press, USA. This book was released on 2008-02-14 with total page 169 pages. Available in PDF, EPUB and Kindle. Book excerpt: What is Life? Decades of research have resulted in the full mapping of the human genome - three billion pairs of code whose functions are only now being understood. The gene's eye view of life, advocated by evolutionary biology, sees living bodies as mere vehicles for the replication of the genetic codes.But for a physiologist, working with the living organism, the view is a very different one. Denis Noble is a world renowned physiologist, and sets out an alternative view to the question - one that becomes deeply significant in terms of the living, breathing organism. The genome is not life itself. Noble argues that far from genes building organisms, they should be seen as prisoners of the organism.The view of life presented in this little, modern, post-genome project reflection on the nature of life, is that of the systems biologist: to understand what life is, we must view it at a variety of different levels, all interacting with each other in a complex web. It is that emergent web, full of feedback between levels, from the gene to the wider environment, that is life. It is a kind of music.Including stories from Noble's own research experience, his work on the heartbeat, musical metaphors, and elements of linguistics and Chinese culture, this very personal and at times deeply lyrical book sets out thesystems biology view of life.