Download or read book A Brief History of Everyone who Ever Lived written by Adam Rutherford and published by . This book was released on 2016 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.
Download or read book Sapiens written by Yuval Noah Harari and published by Harper Collins. This book was released on 2015-02-10 with total page 403 pages. Available in PDF, EPUB and Kindle. Book excerpt: New York Times Readers’ Pick: Top 100 Books of the 21st Century New York Times Bestseller A Summer Reading Pick for President Barack Obama, Bill Gates, and Mark Zuckerberg From a renowned historian comes a groundbreaking narrative of humanity’s creation and evolution—a #1 international bestseller—that explores the ways in which biology and history have defined us and enhanced our understanding of what it means to be “human.” One hundred thousand years ago, at least six different species of humans inhabited Earth. Yet today there is only one—homo sapiens. What happened to the others? And what may happen to us? Most books about the history of humanity pursue either a historical or a biological approach, but Dr. Yuval Noah Harari breaks the mold with this highly original book that begins about 70,000 years ago with the appearance of modern cognition. From examining the role evolving humans have played in the global ecosystem to charting the rise of empires, Sapiens integrates history and science to reconsider accepted narratives, connect past developments with contemporary concerns, and examine specific events within the context of larger ideas. Dr. Harari also compels us to look ahead, because over the last few decades humans have begun to bend laws of natural selection that have governed life for the past four billion years. We are acquiring the ability to design not only the world around us, but also ourselves. Where is this leading us, and what do we want to become? Featuring 27 photographs, 6 maps, and 25 illustrations/diagrams, this provocative and insightful work is sure to spark debate and is essential reading for aficionados of Jared Diamond, James Gleick, Matt Ridley, Robert Wright, and Sharon Moalem.
Download or read book Who We Are and How We Got Here written by David Reich and published by Oxford University Press. This book was released on 2018-03-29 with total page 320 pages. Available in PDF, EPUB and Kindle. Book excerpt: The past few years have witnessed a revolution in our ability to obtain DNA from ancient humans. This important new data has added to our knowledge from archaeology and anthropology, helped resolve long-existing controversies, challenged long-held views, and thrown up remarkable surprises. The emerging picture is one of many waves of ancient human migrations, so that all populations living today are mixes of ancient ones, and often carry a genetic component from archaic humans. David Reich, whose team has been at the forefront of these discoveries, explains what genetics is telling us about ourselves and our complex and often surprising ancestry. Gone are old ideas of any kind of racial âpurity.' Instead, we are finding a rich variety of mixtures. Reich describes the cutting-edge findings from the past few years, and also considers the sensitivities involved in tracing ancestry, with science sometimes jostling with politics and tradition. He brings an important wider message: that we should recognize that every one of us is the result of a long history of migration and intermixing of ancient peoples, which we carry as ghosts in our DNA. What will we discover next?
Download or read book The Book of Humans A Brief History of Culture Sex War and the Evolution of Us written by Adam Rutherford and published by The Experiment, LLC. This book was released on 2020-05-12 with total page 303 pages. Available in PDF, EPUB and Kindle. Book excerpt: “Rutherford describes [The Book of Humans] as being about the paradox of how our evolutionary journey turned ‘an otherwise average ape’ into one capable of creating complex tools, art, music, science, and engineering. It’s an intriguing question, one his book sets against descriptions of the infinitely amusing strategies and antics of a dizzying array of animals.”—The New York Times Book Review Publisher’s Note: The Book of Humans was previously published in hardcover as Humanimal. In this new evolutionary history, geneticist Adam Rutherford explores the profound paradox of the human animal. Looking for answers across the animal kingdom, he finds that many things once considered exclusively human are not: We aren’t the only species that “speaks,” makes tools, or has sex outside of procreation. Seeing as our genome is 98 percent identical to a chimpanzee’s, our DNA doesn’t set us far apart, either. How, then, did we develop the most complex culture ever observed? The Book of Humans proves that we are animals indeed—and reveals how we truly are extraordinary.
Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Download or read book Extra Life written by Steven Johnson and published by Penguin. This book was released on 2021-05-11 with total page 320 pages. Available in PDF, EPUB and Kindle. Book excerpt: “Offers a useful reminder of the role of modern science in fundamentally transforming all of our lives.” —President Barack Obama (on Twitter) “An important book.” —Steven Pinker, The New York Times Book Review The surprising and important story of how humans gained what amounts to an extra life, from the bestselling author of How We Got to Now and Where Good Ideas Come From In 1920, at the end of the last major pandemic, global life expectancy was just over forty years. Today, in many parts of the world, human beings can expect to live more than eighty years. As a species we have doubled our life expectancy in just one century. There are few measures of human progress more astonishing than this increased longevity. Extra Life is Steven Johnson’s attempt to understand where that progress came from, telling the epic story of one of humanity’s greatest achievements. How many of those extra years came from vaccines, or the decrease in famines, or seatbelts? What are the forces that now keep us alive longer? Behind each breakthrough lies an inspiring story of cooperative innovation, of brilliant thinkers bolstered by strong systems of public support and collaborative networks, and of dedicated activists fighting for meaningful reform. But for all its focus on positive change, this book is also a reminder that meaningful gaps in life expectancy still exist, and that new threats loom on the horizon, as the COVID-19 pandemic has made clear. How do we avoid decreases in life expectancy as our public health systems face unprecedented challenges? What current technologies or interventions that could reduce the impact of future crises are we somehow ignoring? A study in how meaningful change happens in society, Extra Life celebrates the enduring power of common goals and public resources, and the heroes of public health and medicine too often ignored in popular accounts of our history. This is the sweeping story of a revolution with immense public and personal consequences: the doubling of the human life span.
Download or read book The Lessons of History written by Will Durant and published by Simon and Schuster. This book was released on 2012-08-21 with total page 128 pages. Available in PDF, EPUB and Kindle. Book excerpt: A concise survey of the culture and civilization of mankind, The Lessons of History is the result of a lifetime of research from Pulitzer Prize–winning historians Will and Ariel Durant. With their accessible compendium of philosophy and social progress, the Durants take us on a journey through history, exploring the possibilities and limitations of humanity over time. Juxtaposing the great lives, ideas, and accomplishments with cycles of war and conquest, the Durants reveal the towering themes of history and give meaning to our own.
Download or read book A Brief History of Thought written by Luc Ferry and published by Harper Collins. This book was released on 2011-12-27 with total page 227 pages. Available in PDF, EPUB and Kindle. Book excerpt: NATIONAL BESTSELLER "Ferry's openness, energy, and charm as a teacher burst through on every page." —Wall Street Journal From the timeless wisdom of the ancient Greeks to Christianity, the Enlightenment, existentialism, and postmodernism, Luc Ferry’s instant classic brilliantly and accessibly explains the enduring teachings of philosophy—including its profound relevance to modern daily life and its essential role in achieving happiness and living a meaningful life. This lively journey through the great thinkers will enlighten every reader, young and old.
Download or read book A Short History of Progress written by Ronald Wright and published by House of Anansi. This book was released on 2004 with total page 226 pages. Available in PDF, EPUB and Kindle. Book excerpt: Each time history repeats itself, so it's said, the price goes up. The twentieth century was a time of runaway growth in human population, consumption, and technology, placing a colossal load on all natural systems, especially earth, air, and water — the very elements of life. The most urgent questions of the twenty-first century are: where will this growth lead? can it be consolidated or sustained? and what kind of world is our present bequeathing to our future?In his #1 bestseller A Short History of Progress Ronald Wright argues that our modern predicament is as old as civilization, a 10,000-year experiment we have participated in but seldom controlled. Only by understanding the patterns of triumph and disaster that humanity has repeated around the world since the Stone Age can we recognize the experiment's inherent dangers, and, with luck and wisdom, shape its outcome.
Download or read book The Epigenetics Revolution written by Nessa Carey and published by Columbia University Press. This book was released on 2012-03-06 with total page 353 pages. Available in PDF, EPUB and Kindle. Book excerpt: Epigenetics can potentially revolutionize our understanding of the structure and behavior of biological life on Earth. It explains why mapping an organism's genetic code is not enough to determine how it develops or acts and shows how nurture combines with nature to engineer biological diversity. Surveying the twenty-year history of the field while also highlighting its latest findings and innovations, this volume provides a readily understandable introduction to the foundations of epigenetics. Nessa Carey, a leading epigenetics researcher, connects the field's arguments to such diverse phenomena as how ants and queen bees control their colonies; why tortoiseshell cats are always female; why some plants need cold weather before they can flower; and how our bodies age and develop disease. Reaching beyond biology, epigenetics now informs work on drug addiction, the long-term effects of famine, and the physical and psychological consequences of childhood trauma. Carey concludes with a discussion of the future directions for this research and its ability to improve human health and well-being.
Download or read book The Dawn of Everything written by David Graeber and published by Farrar, Straus and Giroux. This book was released on 2021-11-09 with total page 384 pages. Available in PDF, EPUB and Kindle. Book excerpt: INSTANT NEW YORK TIMES BESTSELLER A dramatically new understanding of human history, challenging our most fundamental assumptions about social evolution—from the development of agriculture and cities to the origins of the state, democracy, and inequality—and revealing new possibilities for human emancipation. For generations, our remote ancestors have been cast as primitive and childlike—either free and equal innocents, or thuggish and warlike. Civilization, we are told, could be achieved only by sacrificing those original freedoms or, alternatively, by taming our baser instincts. David Graeber and David Wengrow show how such theories first emerged in the eighteenth century as a conservative reaction to powerful critiques of European society posed by Indigenous observers and intellectuals. Revisiting this encounter has startling implications for how we make sense of human history today, including the origins of farming, property, cities, democracy, slavery, and civilization itself. Drawing on pathbreaking research in archaeology and anthropology, the authors show how history becomes a far more interesting place once we learn to throw off our conceptual shackles and perceive what’s really there. If humans did not spend 95 percent of their evolutionary past in tiny bands of hunter-gatherers, what were they doing all that time? If agriculture, and cities, did not mean a plunge into hierarchy and domination, then what kinds of social and economic organization did they lead to? The answers are often unexpected, and suggest that the course of human history may be less set in stone, and more full of playful, hopeful possibilities, than we tend to assume. The Dawn of Everything fundamentally transforms our understanding of the human past and offers a path toward imagining new forms of freedom, new ways of organizing society. This is a monumental book of formidable intellectual range, animated by curiosity, moral vision, and a faith in the power of direct action. Includes Black-and-White Illustrations
Download or read book Origin Story written by David Christian and published by Little, Brown Spark. This book was released on 2018-05-22 with total page 304 pages. Available in PDF, EPUB and Kindle. Book excerpt: This New York Times bestseller "elegantly weaves evidence and insights . . . into a single, accessible historical narrative" (Bill Gates) and presents a captivating history of the universe -- from the Big Bang to dinosaurs to mass globalization and beyond. Most historians study the smallest slivers of time, emphasizing specific dates, individuals, and documents. But what would it look like to study the whole of history, from the big bang through the present day -- and even into the remote future? How would looking at the full span of time change the way we perceive the universe, the earth, and our very existence? These were the questions David Christian set out to answer when he created the field of "Big History," the most exciting new approach to understanding where we have been, where we are, and where we are going. In Origin Story, Christian takes readers on a wild ride through the entire 13.8 billion years we've come to know as "history." By focusing on defining events (thresholds), major trends, and profound questions about our origins, Christian exposes the hidden threads that tie everything together -- from the creation of the planet to the advent of agriculture, nuclear war, and beyond. With stunning insights into the origin of the universe, the beginning of life, the emergence of humans, and what the future might bring, Origin Story boldly reframes our place in the cosmos.
Download or read book The Book of Humans written by Adam Rutherford and published by Weidenfeld & Nicolson. This book was released on 2018 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Explores how many of the things once considered to be exclusively human are not: we are not the only species that communicates, makes tools, utilises fire, or has sex for reasons other than to make new versions of ourselves. Evolution has, however, allowed us to develop our culture to a level of complexity that outstrips any other observed in nature
Download or read book The Fourth Turning written by William Strauss and published by Crown. This book was released on 1997-12-29 with total page 401 pages. Available in PDF, EPUB and Kindle. Book excerpt: NATIONAL BESTSELLER • Discover the game-changing theory of the cycles of history and what past generations can teach us about living through times of upheaval—with deep insights into the roles that Boomers, Generation X, and Millennials have to play—now with a new preface by Neil Howe. First comes a High, a period of confident expansion. Next comes an Awakening, a time of spiritual exploration and rebellion. Then comes an Unraveling, in which individualism triumphs over crumbling institutions. Last comes a Crisis—the Fourth Turning—when society passes through a great and perilous gate in history. William Strauss and Neil Howe will change the way you see the world—and your place in it. With blazing originality, The Fourth Turning illuminates the past, explains the present, and reimagines the future. Most remarkably, it offers an utterly persuasive prophecy about how America’s past will predict what comes next. Strauss and Howe base this vision on a provocative theory of American history. The authors look back five hundred years and uncover a distinct pattern: Modern history moves in cycles, each one lasting about the length of a long human life, each composed of four twenty-year eras—or “turnings”—that comprise history’s seasonal rhythm of growth, maturation, entropy, and rebirth. Illustrating this cycle through a brilliant analysis of the post–World War II period, The Fourth Turning offers bold predictions about how all of us can prepare, individually and collectively, for this rendezvous with destiny.
Download or read book Homo Deus written by Yuval Noah Harari and published by HarperCollins. This book was released on 2017-02-21 with total page 464 pages. Available in PDF, EPUB and Kindle. Book excerpt: Official U.S. edition with full color illustrations throughout. NEW YORK TIMES BESTSELLER Yuval Noah Harari, author of the critically-acclaimed New York Times bestseller and international phenomenon Sapiens, returns with an equally original, compelling, and provocative book, turning his focus toward humanity’s future, and our quest to upgrade humans into gods. Over the past century humankind has managed to do the impossible and rein in famine, plague, and war. This may seem hard to accept, but, as Harari explains in his trademark style—thorough, yet riveting—famine, plague and war have been transformed from incomprehensible and uncontrollable forces of nature into manageable challenges. For the first time ever, more people die from eating too much than from eating too little; more people die from old age than from infectious diseases; and more people commit suicide than are killed by soldiers, terrorists and criminals put together. The average American is a thousand times more likely to die from binging at McDonalds than from being blown up by Al Qaeda. What then will replace famine, plague, and war at the top of the human agenda? As the self-made gods of planet earth, what destinies will we set ourselves, and which quests will we undertake? Homo Deus explores the projects, dreams and nightmares that will shape the twenty-first century—from overcoming death to creating artificial life. It asks the fundamental questions: Where do we go from here? And how will we protect this fragile world from our own destructive powers? This is the next stage of evolution. This is Homo Deus. With the same insight and clarity that made Sapiens an international hit and a New York Times bestseller, Harari maps out our future.
Download or read book Between the World and Me written by Ta-Nehisi Coates and published by One World. This book was released on 2015-07-14 with total page 163 pages. Available in PDF, EPUB and Kindle. Book excerpt: #1 NEW YORK TIMES BESTSELLER • NATIONAL BOOK AWARD WINNER • NAMED ONE OF TIME’S TEN BEST NONFICTION BOOKS OF THE DECADE • PULITZER PRIZE FINALIST • NATIONAL BOOK CRITICS CIRCLE AWARD FINALIST • ONE OF OPRAH’S “BOOKS THAT HELP ME THROUGH” • NOW AN HBO ORIGINAL SPECIAL EVENT Hailed by Toni Morrison as “required reading,” a bold and personal literary exploration of America’s racial history by “the most important essayist in a generation and a writer who changed the national political conversation about race” (Rolling Stone) NAMED ONE OF THE MOST INFLUENTIAL BOOKS OF THE DECADE BY CNN • NAMED ONE OF PASTE’S BEST MEMOIRS OF THE DECADE • NAMED ONE OF THE TEN BEST BOOKS OF THE YEAR BY The New York Times Book Review • O: The Oprah Magazine • The Washington Post • People • Entertainment Weekly • Vogue • Los Angeles Times • San Francisco Chronicle • Chicago Tribune • New York • Newsday • Library Journal • Publishers Weekly In a profound work that pivots from the biggest questions about American history and ideals to the most intimate concerns of a father for his son, Ta-Nehisi Coates offers a powerful new framework for understanding our nation’s history and current crisis. Americans have built an empire on the idea of “race,” a falsehood that damages us all but falls most heavily on the bodies of black women and men—bodies exploited through slavery and segregation, and, today, threatened, locked up, and murdered out of all proportion. What is it like to inhabit a black body and find a way to live within it? And how can we all honestly reckon with this fraught history and free ourselves from its burden? Between the World and Me is Ta-Nehisi Coates’s attempt to answer these questions in a letter to his adolescent son. Coates shares with his son—and readers—the story of his awakening to the truth about his place in the world through a series of revelatory experiences, from Howard University to Civil War battlefields, from the South Side of Chicago to Paris, from his childhood home to the living rooms of mothers whose children’s lives were taken as American plunder. Beautifully woven from personal narrative, reimagined history, and fresh, emotionally charged reportage, Between the World and Me clearly illuminates the past, bracingly confronts our present, and offers a transcendent vision for a way forward.
Download or read book A Little History of the World written by E. H. Gombrich and published by Yale University Press. This book was released on 2014-10-01 with total page 401 pages. Available in PDF, EPUB and Kindle. Book excerpt: E. H. Gombrich's Little History of the World, though written in 1935, has become one of the treasures of historical writing since its first publication in English in 2005. The Yale edition alone has now sold over half a million copies, and the book is available worldwide in almost thirty languages. Gombrich was of course the best-known art historian of his time, and his text suggests illustrations on every page. This illustrated edition of the Little History brings together the pellucid humanity of his narrative with the images that may well have been in his mind's eye as he wrote the book. The two hundred illustrations—most of them in full color—are not simple embellishments, though they are beautiful. They emerge from the text, enrich the author's intention, and deepen the pleasure of reading this remarkable work. For this edition the text is reset in a spacious format, flowing around illustrations that range from paintings to line drawings, emblems, motifs, and symbols. The book incorporates freshly drawn maps, a revised preface, and a new index. Blending high-grade design, fine paper, and classic binding, this is both a sumptuous gift book and an enhanced edition of a timeless account of human history.