Download or read book The Search for Life s Origins written by National Research Council and published by National Academies Press. This book was released on 1990-02-01 with total page 161 pages. Available in PDF, EPUB and Kindle. Book excerpt: The field of planetary biology and chemical evolution draws together experts in astronomy, paleobiology, biochemistry, and space science who work together to understand the evolution of living systems. This field has made exciting discoveries that shed light on how organic compounds came together to form self-replicating molecules-the origin of life. This volume updates that progress and offers recommendations on research programs-including an ambitious effort centered on Mars-to advance the field over the next 10 to 15 years. The book presents a wide range of data and research results on these and other issues: The biogenic elements and their interaction in the interstellar clouds and in solar nebulae. Early planetary environments and the conditions that lead to the origin of life. The evolution of cellular and multicellular life. The search for life outside the solar system. This volume will become required reading for anyone involved in the search for life's beginnings-including exobiologists, geoscientists, planetary scientists, and U.S. space and science policymakers.
Download or read book Origins Abiogenesis and the Search for Life written by Michael Russell and published by Cosmology.com. This book was released on 2010-10 with total page 516 pages. Available in PDF, EPUB and Kindle. Book excerpt: What is the origin of life? How did life begin? The question of life's origins has been asked for thousands of years and a variety of theories have been proposed. Yet, perhaps the right question has never been asked, which is, what does life do? To understand life, we must understand what it is, what it does, how it evolved from simple chemicals to self-replicating molecule, and then the questions of origins can be properly addressed. Did life begin in a deep sea thermal vent, or in an alkaline world? What were the role of viruses in kick starting life? Did life emerge from disequilibrium? What is the source of pre-genetic information? Did vesicles come first, or only after life had begun? In this text, over 20 of the world's leading scientists ask, and answer the hard questions, and in so doing may have ushered in a paradigm shift, and a scientific revolution in our understanding of the nature of life and its origins.
Download or read book Origins of Life How Life Began Abiogenesis Astrobiology written by Nick Lane and published by . This book was released on 2011-11 with total page 528 pages. Available in PDF, EPUB and Kindle. Book excerpt: How Did Life Begin? There are two scientific views on the origins of life: 1) Earthly-Abiogenesis which argues life on Earth began on Earth, and 2) Extraterrestrial Abiogenesis the position of which is life has an ancestry which predates the origins of Earth, and is pervasive throughout the cosmos. Thus, both theories embrace abiogenesis" and both argue that life may have begun on innumerable planets via the same mechanisms. In this ground-breaking, revolutionary text, over 30 top scientists from around the world, explain how life began and if there is life on other worlds, in over 20 paradigm busting chapters. PART I: Earthly Abiogenesis & the Origins of Life 1. Why Does Life Start, What Does It Do, Where Will It Be, And How Might We Find It? Michael J. Russell, Ph.D., and Isik Kanik, Ph.D., 2. Just Like the Universe the Emergence of Life had High Enthalpy and Low Entropy Beginnings, Wolfgang Nitschke, Ph.D., and Michael J. Russell, Ph.D. 3. Polyphosphate-Peptide Synergy and the Organic Takeover at the Emergence of Life. E. James Milner-White, Ph.D., and Michael J. Russell, Ph.D. 4. The Alkaline World and the Origin of Life. Anthony Richard Mellersh, Ph.D., and Paul Michael Smith, 5. Amino Acid Homochirality and the RNA World: Necessities for Life on Earth, Koji Tamura, Ph.D., 6. The RNA World and the Origin of Life: An Ancient Protein Fold Links Metal-Based Gas Reactions with the RNA World. Anne Volbeda, Ph.D., Yvain Nicolet, Ph.D., and Juan C. Fontecilla-Camps, Ph.D. 7. Evolutionary Steps to the Origin of Life on Earth. Andrew J. Pratt, D. Phil. 8. Vesicles First and the Origin of Self-Reproductive Life: Metabolic Energy, Replication, and Catalysis. Arthur L. Koch, Ph.D., 9. Chance or Necessity? Bioenergetics and the Probability of Life. Nick Lane, Ph.D. 10. Disequilibrium First: The Origin of Life Christof B. Mast, Ph.D., Natan Osterman, Ph.D., and Dieter Braun, Ph.D. 11. Life's Origins: Potential for Radical Mediated Cyanide Production on the Early Earth, Shawn E. McGlynn, Ph.D., Trevor E. Beard, Joan B. Broderick, Ph.D., and John W. Peters, Ph.D. 12. The Emergence of Life: Thermodynamics of Chemical Free Energy Generation in Off-Axis Hydrothermal Vent Systems & Consequences for Compartmentalization & Life's Origins. Eugenio Simoncini, Ph.D., Axel Kleidon, Ph.D., Enzo Gallori, Ph.D. 13. How Life Began: The Emergence of Sparse Metabolic Networks, Shelley D. Copley, Ph.D., Eric Smith, Ph.D., and Harold J. Morowitz, Ph.D., 14. Redox Homeostasis in the Emergence of Life. On the Constant Internal Environment of Nascent Living Cells, John F. Allen, Ph.D. 15. Reconstruction of the Molecular Origin of Life. Edward N. Trifonov, Ph.D., 16. How Primordial Cells Assembled Biosynthetic Pathways, Marco Fondi, Ph.D., Giovanni Emiliani, Ph.D., Renato Fani, Ph.D., 17. On the Emergence of Pre-Genetic Information. Ernesto Di Mauro, Ph.D., 18. Implications For An RNA-Clay World: Interaction Of Cytosine With Clay Minerals, A. Pucci, Ph.D., et al. 19. Viruses and Life: Can There Be One Without the Other? Matti Jalasvuori, Ph.D., and Jaana K.H. Bamford, Ph.D., 20. The Origin of Eukaryotes: Archae, Bacteria, Viruses and Horizontal Gene Transfer, R. Joseph, Ph.D. 21. What Can the Origin of Life on Earth Tell Us About the Cosmos? Stephen Freeland, Ph.D., and Gayle K. Philip, Ph.D. PART II: Extra-Terrestrial Abiogenesis 22. 1. Biological Cosmology and the Origins of Life in the Universe, R. Joseph, Ph.D., Rudolf Schild, Ph.D 23. First Life in the Oceans of Primordial-Planets: The Biological Big Bang. C.H. Gibson, Ph.D., N.C. Wickramasinghe, Ph.D., R.E. Schild, Ph.D 24. Genetics Indicates Extra-Terrestrial Origins of Life: the First Gene. R. Joseph, Ph.D., Rudolf Schild, Ph.D., N.C. Wickramasinghe, Ph.D.,
Download or read book Origin of Life written by David W. Deamer and published by Oxford University Press, USA. This book was released on 2020 with total page 125 pages. Available in PDF, EPUB and Kindle. Book excerpt: "I'll begin with a challenging question: Why should anyone want to know about the origin of life? The answers will vary from one person to the next, but the simplest answer is curiosity. Anyone reading this introduction is curious because they wonder how life could have begun on the Earth, but there is more to it than that. My friend Stuart Kauffman wrote a book with the title At Home in the Universe. The title refers to a deep sense of satisfaction that comes when we begin to understand how our lives on Earth are connected to the rest of the universe. There are surprises and revelations as we discover those connections"--
Download or read book A New History of Life written by Peter Ward and published by Bloomsbury Publishing USA. This book was released on 2015-04-07 with total page 401 pages. Available in PDF, EPUB and Kindle. Book excerpt: The history of life on Earth is, in some form or another, known to us all--or so we think. A New History of Life offers a provocative new account, based on the latest scientific research, of how life on our planet evolved--the first major new synthesis for general readers in two decades. Charles Darwin's theories, first published more than 150 years ago, form the backbone of how we understand the history of the Earth. In reality, the currently accepted history of life on Earth is so flawed, so out of date, that it's past time we need a 'New History of Life.' In their latest book, Joe Kirschvink and Peter Ward will show that many of our most cherished beliefs about the evolution of life are wrong. Gathering and analyzing years of discoveries and research not yet widely known to the public, A New History of Life proposes a different origin of species than the one Darwin proposed, one which includes eight-foot-long centipedes, a frozen “snowball Earth”, and the seeds for life originating on Mars. Drawing on their years of experience in paleontology, biology, chemistry, and astrobiology, experts Ward and Kirschvink paint a picture of the origins life on Earth that are at once too fabulous to imagine and too familiar to dismiss--and looking forward, A New History of Life brilliantly assembles insights from some of the latest scientific research to understand how life on Earth can and might evolve far into the future.
Download or read book Beyond the Stars written by Paolo Saraceno and published by World Scientific. This book was released on 2012 with total page 388 pages. Available in PDF, EPUB and Kindle. Book excerpt: "The first part discusses the origins of everything, from the Big Bang to humankind. It follows the long course of evolution - from original matter to the formation of more complex structures, from the furthest galaxies to the nearest stars, from planets to organic molecules, from the first and most elementary forms of life through to the reptiles, the dinosaurs and the advent of man. The second part traces the history of the Earth and evaluates the risks of extinction in the future as predicted by scientists. Is the Earth the only habitable planet in the Universe? This question initiates the discussion on the importance of the Earth's position in the solar system and the significance of our geologically alive planet. The final part is dedicated to the search for extraterrestrial beings with identifiable life forms. It also describes attempts for searching, from the past to the near future." --Publisher's website.
Download or read book Seven Clues to the Origin of Life written by Alexander Graham Cairns-Smith and published by Cambridge University Press. This book was released on 1990-09-13 with total page 148 pages. Available in PDF, EPUB and Kindle. Book excerpt: The mysteries surrounding the origins of life on earth are written in detective story fashion by a world famous scientist in this popular version of Genetic Takeover, originally published in 1982.
Download or read book The Origin of Life written by Paul Davies and published by Penguin UK. This book was released on 2006-09-28 with total page 320 pages. Available in PDF, EPUB and Kindle. Book excerpt: The origins of life remains one of the great unsolved mysteries of science. Growing evidence suggests that the first organisms lived deep underground, in environments previously thought to be uninhabitable, and that microbes carried inside rocks have travelled between Earth and Mars. But the question remains: how can life spring into being from non-living chemicals? THE FIFTH MIRACLE reveals the remarkable new theories and discoveries that seem set to transform our understanding of life's role in the unfolding drama of the cosmos.
Download or read book Abiogenesis written by Paul F. Kisak and published by Createspace Independent Publishing Platform. This book was released on 2016-08-12 with total page 180 pages. Available in PDF, EPUB and Kindle. Book excerpt: Abiogenesis has become a maturing field of study as an alternative to the creationist or intelligent design theory of the origin of life on earth. Abiogenesis, Biopoiesis or OoL (Origins of Life), is the natural process of life arising from non-living matter, such as simple organic compounds. It is thought to have occurred on Earth between 3.8 and 4.1 billion years ago. Abiogenesis is studied through a combination of laboratory experiments and extrapolation from the characteristics of modern organisms, and aims to determine how pre-life chemical reactions gave rise to life on Earth. The study of abiogenesis involves geophysical, chemical, and biological considerations, with more recent approaches attempting a synthesis of all three. Many approaches investigate how self-replicating molecules, or their components, came into existence. It is generally thought that current life on Earth is descended from an RNA world, although RNA-based life may not have been the first life to have existed. The classic Miller-Urey experiment and similar research demonstrated that most amino acids, the basic chemical constituents of the proteins used in all living organisms, can be synthesized from inorganic compounds under conditions intended to replicate those of the early Earth. Various external sources of energy that may have triggered these reactions have been proposed, including lightning and radiation. Other approaches ("metabolism-first" hypotheses) focus on understanding how catalysis in chemical systems on the early Earth might have provided the precursor molecules necessary for self-replication. Complex organic molecules have been found in the Solar System and in interstellar space, and these molecules may have provided starting material for the development of life on Earth. The panspermia hypothesis alternatively suggests that microscopic life was distributed to the early Earth by meteoroids, asteroids and other small Solar System bodies and that life may exist throughout the Universe. Given the revised and more accurate models of "The Drake Equation" and the knowledge gained on the Tardigrade species, it is very probable that some simple form of life has been deposited on earth via asteroids, meteorites or some similar phenomena. It is speculated that the biochemistry of life may have begun shortly after the Big Bang, 13.8 billion years ago, during a habitable epoch when the age of the universe was only 10 to 17 million years. The panspermia hypothesis therefore answers questions of where, not how, life came to be; it only postulates that life may have originated in a locale outside the Earth. Currently, Earth remains the only place in the Universe observed to harbor life, and fossil evidence from the Earth supplies most studies of abiogenesis. Precambrian stromatolites were found in the Siyeh Formation of The Glacier National Park. A paper in the scientific journal "Nature" 2002 suggested that these 3.5 Ga (billion years) old geological formations contain fossilized cyanobacteriamicrobes. This suggests they are evidence of one of the earliest known life forms on Earth. The age of the Earth is about 4.54 billion years; the earliest undisputed evidence of life on Earth dates from at least 3.5 billion years ago, and possibly as early as the Eoarchean Era, after a geological crust started to solidify following the earlier molten Hadean Eon. Microbial mat fossils have been found in 3.48 billion-year-old sandstone in Western Australia. Other early physical evidence of biogenic substances includes graphite discovered in 3.7 billion-year-old metasedimentary rocks in southwestern Greenland, as well as "remains of biotic life" found in 4.1 billion-year-old rocks in Western Australia. According to one of the researchers, "If life arose relatively quickly on Earth ... then it could be common in the universe." This book discusses the various methods and Evidence for the development of life on Earth by natural means.
Download or read book The Origins of Life written by D. W. Deamer and published by Cold Spring Harbor Perspective. This book was released on 2010 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Life arose on Earth more than three billion years ago. How the first self-replicating systems emerged from prebiotic chemistry and evolved into primitive cell-like entities is an area of intense research, spanning molecular and cellular biology, organic chemistry, cosmology, geology, and atmospheric science. Written and edited by experts in the field, this collection from Cold Spring Harbor Perspectives in Biology provides a comprehensive account of the environment of the early Earth and the mechanisms by which the organic molecules present may have self-assembled to form replicating material such as RNA and other polymers. The contributors examine the energetic requirements for this process and focus in particular on the essential role of semi-permeable compartments in containment of primitive genetic systems. Also covered in the book are new synthetic approaches for fabricating cellular systems, the potentially extraterrestrial origin of life's building blocks, and the possibility that life once existed on Mars. Comprising five sections Setting the Stage, Components of First Life, Primitive Systems, First Polymers, and Transition to a Microbial World it is a vital reference for all scientists interested in the origin of life on Earth and the likelihood that it has arisen on other planets
Download or read book The Origins of Life written by Cyril Ponnamperuma and published by . This book was released on 1972 with total page 224 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book The Origins of Life written by Hoimar von Ditfurth and published by HarperCollins Publishers. This book was released on 1982 with total page 314 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Astrobiology written by Akihiko Yamagishi and published by Springer. This book was released on 2019-02-27 with total page 465 pages. Available in PDF, EPUB and Kindle. Book excerpt: This book provides concise and cutting-edge reviews in astrobiology, a young and still emerging multidisciplinary field of science that addresses the fundamental questions of how life originated and diversified on Earth, whether life exists beyond Earth, and what is the future for life on Earth. Readers will find coverage of the latest understanding of a wide range of fascinating topics, including, for example, solar system formation, the origins of life, the history of Earth as revealed by geology, the evolution of intelligence on Earth, the implications of genome data, insights from extremophile research, and the possible existence of life on other planets within and beyond the solar system. Each chapter contains a brief summary of the current status of the topic under discussion, sufficient references to enable more detailed study, and descriptions of recent findings and forthcoming missions or anticipated research. Written by leading experts in astronomy, planetary science, geoscience, chemistry, biology, and physics, this insightful and thought-provoking book will appeal to all students and scientists who are interested in life and space.
Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Download or read book A Brief History of Creation Science and the Search for the Origin of Life written by Bill Mesler and published by W. W. Norton & Company. This book was released on 2015-12-07 with total page 289 pages. Available in PDF, EPUB and Kindle. Book excerpt: The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.
Download or read book The Origin of Life written by John Keosian and published by . This book was released on 1968 with total page 136 pages. Available in PDF, EPUB and Kindle. Book excerpt: