Download or read book The Origin and Nature of Life on Earth written by Eric Smith and published by Cambridge University Press. This book was released on 2016-03-31 with total page 703 pages. Available in PDF, EPUB and Kindle. Book excerpt: Uniting the foundations of physics and biology, this groundbreaking multidisciplinary and integrative book explores life as a planetary process.
Download or read book Life written by Aleksandr Ivanovich Oparin and published by . This book was released on 1964 with total page 207 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Life Itself written by Robert Rosen and published by Columbia University Press. This book was released on 1991 with total page 324 pages. Available in PDF, EPUB and Kindle. Book excerpt: Why are living things alive? As a theoretical biologist, Robert Rosen saw this as the most fundamental of all questions-and yet it had never been answered satisfactorily by science. The answers to this question would allow humanity to make an enormous leap forward in our understanding of the principles at work in our world. For centuries, it was believed that the only scientific approach to the question "What is life?" must proceed from the Cartesian metaphor (organism as machine). Classical approaches in science, which also borrow heavily from Newtonian mechanics, are based on a process called "reductionism." The thinking was that we can better learn about an intricate, complicated system (like an organism) if we take it apart, study the components, and then reconstruct the system-thereby gaining an understanding of the whole. However, Rosen argues that reductionism does not work in biology and ignores the complexity of organisms. Life Itself, a landmark work, represents the scientific and intellectual journey that led Rosen to question reductionism and develop new scientific approaches to understanding the nature of life. Ultimately, Rosen proposes an answer to the original question about the causal basis of life in organisms. He asserts that renouncing the mechanistic and reductionistic paradigm does not mean abandoning science. Instead, Rosen offers an alternate paradigm for science that takes into account the relational impacts of organization in natural systems and is based on organized matter rather than on particulate matter alone. Central to Rosen's work is the idea of a "complex system," defined as any system that cannot be fully understood by reducing it to its parts. In this sense, complexity refers to the causal impact of organization on the system as a whole. Since both the atom and the organism can be seen to fit that description, Rosen asserts that complex organization is a general feature not just of the biosphere on Earth-but of the universe itself.
Download or read book Life Its Nature Origin Development and the Psychical Related to the Physical written by Salem Wilder and published by . This book was released on 1886 with total page 368 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Life Its Nature and Origin written by Jerome B 1876 Alexander and published by Legare Street Press. This book was released on 2023-07-22 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: In this groundbreaking work, Alexander explores the nature of life itself, from its molecular building blocks to its complex evolutionary history. Drawing on the latest scientific discoveries and insights, he presents a comprehensive and compelling account of the origins and development of life on Earth. A must-read for anyone interested in biology, evolution, and the mysteries of the living world. This work has been selected by scholars as being culturally important, and is part of the knowledge base of civilization as we know it. This work is in the "public domain in the United States of America, and possibly other nations. Within the United States, you may freely copy and distribute this work, as no entity (individual or corporate) has a copyright on the body of the work. Scholars believe, and we concur, that this work is important enough to be preserved, reproduced, and made generally available to the public. We appreciate your support of the preservation process, and thank you for being an important part of keeping this knowledge alive and relevant.
Download or read book Life written by Salem Wilder and published by Palala Press. This book was released on 2016-05-22 with total page pages. Available in PDF, EPUB and Kindle. Book excerpt: This work has been selected by scholars as being culturally important, and is part of the knowledge base of civilization as we know it. This work was reproduced from the original artifact, and remains as true to the original work as possible. Therefore, you will see the original copyright references, library stamps (as most of these works have been housed in our most important libraries around the world), and other notations in the work. This work is in the public domain in the United States of America, and possibly other nations. Within the United States, you may freely copy and distribute this work, as no entity (individual or corporate) has a copyright on the body of the work. As a reproduction of a historical artifact, this work may contain missing or blurred pages, poor pictures, errant marks, etc. Scholars believe, and we concur, that this work is important enough to be preserved, reproduced, and made generally available to the public. We appreciate your support of the preservation process, and thank you for being an important part of keeping this knowledge alive and relevant.
Download or read book Origins and Evolution of Life written by Muriel Gargaud and published by Cambridge University Press. This book was released on 2011-01-06 with total page 547 pages. Available in PDF, EPUB and Kindle. Book excerpt: Devoted to exploring questions about the origin and evolution of life in our Universe, this highly interdisciplinary book brings together a broad array of scientists. Thirty chapters assembled in eight major sections convey the knowledge accumulated and the richness of the debates generated by this challenging theme. The text explores the latest research on the conditions and processes that led to the emergence of life on Earth and, by extension, perhaps on other planetary bodies. Diverse sources of knowledge are integrated, from astronomical and geophysical data, to the role of water, the origin of minimal life properties and the oldest traces of biological activity on our planet. This text will not only appeal to graduate students but to the large body of scientists interested in the challenges presented by the origin of life, its evolution, and its possible existence beyond Earth.
Download or read book Life Its Nature Origin and Development written by Aleksandr Ivanovich Oparin and published by . This book was released on 1962 with total page 246 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Life Its Nature Origin Development and the Psychical Related to the Physical Classic Reprint written by Salem Wilder and published by Forgotten Books. This book was released on 2017-07-18 with total page 366 pages. Available in PDF, EPUB and Kindle. Book excerpt: Excerpt from Life, Its Nature, Origin, Development, and the Psychical Related to the Physical Certain imperfectly understood teachings of nature have been perverted by a class of eminent men, and some one should restate these teachings from a different point of view. The writer has endeavored not to state as fact what does not rest upon good authority; but in writing What follows he assumes a serious responsibility. In the border lands of theory and speculation the lines of truth are not always clearly defined. To mislead is easy, and to mislead in important lines of thought may do harm; yet men must bear the responsibility of their honest convictions. About the Publisher Forgotten Books publishes hundreds of thousands of rare and classic books. Find more at www.forgottenbooks.com This book is a reproduction of an important historical work. Forgotten Books uses state-of-the-art technology to digitally reconstruct the work, preserving the original format whilst repairing imperfections present in the aged copy. In rare cases, an imperfection in the original, such as a blemish or missing page, may be replicated in our edition. We do, however, repair the vast majority of imperfections successfully; any imperfections that remain are intentionally left to preserve the state of such historical works.
Download or read book In Search of Cell History written by Franklin M. Harold and published by University of Chicago Press. This book was released on 2014-10-29 with total page 318 pages. Available in PDF, EPUB and Kindle. Book excerpt: This comprehensive history of cell evolution “deftly discusses the definition of life” as well as cellular organization, classification and more (San Francisco Book Review). The origin of cells remains one of the most fundamental mysteries in biology, one that has spawned a large body of research and debate over the past two decades. With In Search of Cell History, Franklin M. Harold offers a comprehensive, impartial take on that research and the controversies that keep the field in turmoil. Written in accessible language and complemented by a glossary for easy reference, this book examines the relationship between cells and genes; the central role of bioenergetics in the origin of life; the status of the universal tree of life with its three stems and viral outliers; and the controversies surrounding the last universal common ancestor. Harold also discusses the evolution of cellular organization, the origin of complex cells, and the incorporation of symbiotic organelles. In Search of Cell History shows us just how far we have come in understanding cell evolution—and the evolution of life in general—and how far we still have to go. “Wonderful…A loving distillation of connections within the incredible diversity of life in the biosphere, framing one of biology’s most important remaining questions: how did life begin?”—Nature
Download or read book Mind in Nature written by Henry James Clark and published by . This book was released on 1865 with total page 348 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book The Origin of Life written by John Butler Burke and published by . This book was released on 1906 with total page 428 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book The Origins of Life written by John Maynard Smith and published by Oxford University Press, USA. This book was released on 2000 with total page 191 pages. Available in PDF, EPUB and Kindle. Book excerpt: Presents, for the general readership, the novel picture of evolution proposed in the 1995 book, The major transitions in evolution.
Download or read book Life written by and published by . This book was released on 1961 with total page pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book The Origins of Life Molecules and Natural Selection written by Leslie E. Orgel and published by John Wiley & Sons. This book was released on 1973 with total page 258 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Download or read book The Origin of Life written by John Desmond Bernal and published by . This book was released on 1967 with total page 388 pages. Available in PDF, EPUB and Kindle. Book excerpt:
