Download or read book Was Life Created written by Watch Tower Bible and Tract Society of Pennsylvania and published by . This book was released on 2010 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Probable Impossibilities written by Alan Lightman and published by Vintage. This book was released on 2022-04-19 with total page 209 pages. Available in PDF, EPUB and Kindle. Book excerpt: The acclaimed author of Einstein’s Dreams tackles "big questions like the origin of the universe and the nature of consciousness ... in an entertaining and easily digestible way” (Wall Street Journal) with a collection of meditative essays on the possibilities—and impossibilities—of nothingness and infinity, and how our place in the cosmos falls somewhere in between. Can space be divided into smaller and smaller units, ad infinitum? Does space extend to larger and larger regions, on and on to infinity? Is consciousness reducible to the material brain and its neurons? What was the origin of life, and can biologists create life from scratch in the lab? Physicist and novelist Alan Lightman, whom The Washington Post has called “the poet laureate of science writers,” explores these questions and more—from the anatomy of a smile to the capriciousness of memory to the specialness of life in the universe to what came before the Big Bang. Probable Impossibilities is a deeply engaged consideration of what we know of the universe, of life and the mind, and of things vastly larger and smaller than ourselves.
Download or read book The Story of Earth written by Robert M. Hazen and published by Penguin. This book was released on 2013-07-30 with total page 322 pages. Available in PDF, EPUB and Kindle. Book excerpt: Hailed by The New York Times for writing “with wonderful clarity about science . . . that effortlessly teaches as it zips along,” nationally bestselling author Robert M. Hazen offers a radical new approach to Earth history in this intertwined tale of the planet’s living and nonliving spheres. With an astrobiologist’s imagination, a historian’s perspective, and a naturalist’s eye, Hazen calls upon twenty-first-century discoveries that have revolutionized geology and enabled scientists to envision Earth’s many iterations in vivid detail—from the mile-high lava tides of its infancy to the early organisms responsible for more than two-thirds of the mineral varieties beneath our feet. Lucid, controversial, and on the cutting edge of its field, The Story of Earth is popular science of the highest order. "A sweeping rip-roaring yarn of immense scope, from the birth of the elements in the stars to meditations on the future habitability of our world." -Science "A fascinating story." -Bill McKibben
Download or read book Exquisite written by Suzanne Slade and published by Abrams. This book was released on 2020-04-07 with total page 48 pages. Available in PDF, EPUB and Kindle. Book excerpt: A picture-book biography of celebrated poet Gwendolyn Brooks, the first Black person to win the Pulitzer Prize A 2021 Coretta Scott King Book Award Illustrator Honor Book A 2021 Robert F. Sibert Informational Honor Book A 2021 Association of Library Service to Children Notable Children's Book Gwendolyn Brooks (1917–2000) is known for her poems about “real life.” She wrote about love, loneliness, family, and poverty—showing readers how just about anything could become a beautiful poem. Exquisite follows Gwendolyn from early girlhood into her adult life, showcasing her desire to write poetry from a very young age. This picture-book biography explores the intersections of race, gender, and the ubiquitous poverty of the Great Depression—all with a lyrical touch worthy of the subject. Gwendolyn Brooks was the first Black person to win the Pulitzer Prize, receiving the award for poetry in 1950. And in 1958, she was named the poet laureate of Illinois. A bold artist who from a very young age dared to dream, Brooks will inspire young readers to create poetry from their own lives.
Download or read book Science and Creationism written by National Academy of Sciences (U.S.) and published by National Academies Press. This book was released on 1999 with total page 48 pages. Available in PDF, EPUB and Kindle. Book excerpt: This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)
Download or read book Biocentrism written by Robert Lanza and published by ReadHowYouWant.com. This book was released on 2011 with total page 298 pages. Available in PDF, EPUB and Kindle. Book excerpt: Robert Lanza is one of the most respected scientists in the world a US News and World Report cover story called him a genius and a renegade thinker, even likening him to Einstein. Lanza has teamed with Bob Berman, the most widely read astronomer in the world, to produce Biocentrism, a revolutionary new view of the universe. Every now and then a simple yet radical idea shakes the very foundations of knowledge. The startling discovery that the world was not flat challenged and ultimately changed the way people perceived themselves and their relationship with the world. For most humans of the 15th century, the notion of Earth as ball of rock was nonsense. The whole of Western, natural philosophy is undergoing a sea change again, increasingly being forced upon us by the experimental findings of quantum theory, and at the same time, toward doubt and uncertainty in the physical explanations of the universes genesis and structure. Biocentrism completes this shift in worldview, turning the planet upside down again with the revolutionary view that life creates the universe instead of the other way around. In this paradigm, life is not an accidental byproduct of the laws of physics. Biocentrism takes the reader on a seemingly improbable but ultimately inescapable journey through a foreign universe our own from the viewpoints of an acclaimed biologist and a leading astronomer. Switching perspective from physics to biology unlocks the cages in which Western science has unwittingly managed to confine itself. Biocentrism will shatter the readers ideas of life--time and space, and even death. At the same time it will release us from the dull worldview of life being merely the activity of an admixture of carbon and a few other elements; it suggests the exhilarating possibility that life is fundamentally immortal. The 21st century is predicted to be the Century of Biology, a shift from the previous century dominated by physics. It seems fitting, then, to begin the century by turning the universe outside-in and unifying the foundations of science with a simple idea discovered by one of the leading life-scientists of our age. Biocentrism awakens in readers a new sense of possibility, and is full of so many shocking new perspectives that the reader will never see reality the same way again.
Download or read book Creation Facts of Life written by Gary Parker and published by New Leaf Publishing Group. This book was released on 2006-08 with total page 242 pages. Available in PDF, EPUB and Kindle. Book excerpt: In Creation Facts of Life, Dr. Parker respectfully describes the evidences he once used to "preach" evolution - but then he explains how the "rest of the evidence" points away from evolution and toward a perfect world created by God, ruined by man, restored to new life in Christ!
Download or read book Life s Edge written by Carl Zimmer and published by Pan Macmillan. This book was released on 2021-03-18 with total page 480 pages. Available in PDF, EPUB and Kindle. Book excerpt: ‘This book is not just about life, but about discovery itself. It is about error and hubris, but also about wonder and the reach of science. And it is bookended with the ultimate question: How do we define the thing that defines us?’ – Siddhartha Mukherjee, author of The Gene We all assume we know what life is, but the more scientists learn about the living world – from protocells to brains, from zygotes to pandemic viruses – the harder they find it to locate the edges of life, where it begins and ends. What exactly does it mean to be alive? Is a virus alive? Is a foetus? Carl Zimmer investigates one of the biggest questions of all: What is life? The answer seems obvious until you try to seriously answer it. Is the apple sitting on your kitchen counter alive, or is only the apple tree it came from deserving of the word? If we can’t answer that question here on earth, how will we know when and if we discover alien life on other worlds? The question hangs over some of society’s most charged conflicts – whether a fertilized egg is a living person, for example, and when we ought to declare a person legally dead. Life’s Edge is an utterly fascinating investigation by one of the most celebrated science writers of our time. Zimmer journeys through the strange experiments that have attempted to recreate life. Literally hundreds of definitions of what that should look like now exist, but none has yet emerged as an obvious winner. Lists of what living things have in common do not add up to a theory of life. It’s never clear why some items on the list are essential and others not. Coronaviruses have altered the course of history, and yet many scientists maintain they are not alive. Chemists are creating droplets that can swarm, sense their environment, and multiply – have they made life in the lab? Whether he is handling pythons in Alabama or searching for hibernating bats in the Adirondacks, Zimmer revels in astounding examples of life at its most bizarre. He tries his own hand at evolving life in a test tube with unnerving results. Charting the obsession with Dr Frankenstein’s monster and how Coleridge came to believe the whole universe was alive, Zimmer leads us all the way into the labs and minds of researchers working on engineering life from the ground up.
Download or read book God Created the Sea Life of the World written by Earl Snellenberger and published by Master Books. This book was released on 1989 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Contains pictures of various marine fishes with a short description of each.
Download or read book The Mystery of Life s Origin written by Charles B. Thaxton and published by . This book was released on 2020-01-27 with total page 486 pages. Available in PDF, EPUB and Kindle. Book excerpt: The origin of life from non-life remains one of the most enduring mysteries of modern science. This book investigates how close scientists are to solving that mystery and explores what we are learning about the origin of life from current research in chemistry, physics, astrobiology, biochemistry, and more.
Download or read book The First Book of Moses Called Genesis written by and published by Grove/Atlantic, Inc.. This book was released on 1999 with total page 146 pages. Available in PDF, EPUB and Kindle. Book excerpt: Hailed as "the most radical repackaging of the Bible since Gutenberg", these Pocket Canons give an up-close look at each book of the Bible.
Download or read book Created for Influence written by William L. Ford and published by . This book was released on 2007 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Created for Influence calls readers to transform the culture through intercession and action, breaking the power of personal and national strongholds.
Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Download or read book Naturwissenschaft Religion und Die Zukunft Des Menschen written by Hoimar von Ditfurth and published by . This book was released on 1982 with total page 279 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Created Equal Reflections On The Unalienable Right To Life written by Thomas A. Glessner, J.D. and published by Page Publishing Inc. This book was released on 2016-07-22 with total page pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book Creation the Facts of Life written by Gary Parker and published by . This book was released on 1980 with total page 162 pages. Available in PDF, EPUB and Kindle. Book excerpt:
Download or read book The True Christian Religion written by Emanuel Swedenborg and published by . This book was released on 1906 with total page 442 pages. Available in PDF, EPUB and Kindle. Book excerpt: