Download or read book How Humankind Created Science written by Falin Chen and published by Springer Nature. This book was released on 2020-04-27 with total page 601 pages. Available in PDF, EPUB and Kindle. Book excerpt: The development of science has been an ideological struggle that lasted over three millennia. At and after the times of the Babylonian Empire, however, the pace of scientific evolution was painfully slow. This situation changed after Copernicus kick-started the Scientific Revolution with his heliocentric theory. Newton’s law of universal gravitation transformed natural philosophy, previously focused on mythology and abstract philosophical thinking, into an orderly and rational physical science. Einstein’s redefinition of space and time revealed a new and central principle of the Universe, paving the way for the huge amounts of energy held deep inside physical matter to be released. To this day, many of the our known physical theories represent an accumulation of changing knowledge over the long course of scientific history. But what kind of changes did the scientists see? What questions did they address? What methods did they use? What difficulties did they encounter? And what kind of persecution might they have faced on the road to discovering these beautiful, sometimes almost mystical, ideas? This book’s purpose is to investigate these questions. It leads the reader through the stories behind major scientific advancements and their theories, as well as explaining associated examples and hypotheses. Over the course of the journey, readers will come to understand the way scientists explore nature and how scientific theories are applied to natural phenomena and every-day technology.
Download or read book Understanding Scientific Theories of Origins written by Robert C. Bishop and published by InterVarsity Press. This book was released on 2018-12-04 with total page 690 pages. Available in PDF, EPUB and Kindle. Book excerpt: From five authors with over two decades of experience teaching origins together in the classroom, this is the first textbook to offer a full-fledged discussion of the scientific narrative of origins from the Big Bang through humankind, from biblical and theological perspectives. This work gives the reader a detailed picture of mainstream scientific theories of origins along with how they fit into the story of God's creative and redemptive action.
Download or read book Science and Creationism written by National Academy of Sciences (U.S.) and published by National Academies Press. This book was released on 1999 with total page 48 pages. Available in PDF, EPUB and Kindle. Book excerpt: This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)
Download or read book Why Science Does Not Disprove God written by Amir D. Aczel and published by Harper Collins. This book was released on 2014-04-15 with total page 258 pages. Available in PDF, EPUB and Kindle. Book excerpt: The renowned science writer, mathematician, and bestselling author of Fermat's Last Theorem masterfully refutes the overreaching claims the "New Atheists," providing millions of educated believers with a clear, engaging explanation of what science really says, how there's still much space for the Divine in the universe, and why faith in both God and empirical science are not mutually exclusive. A highly publicized coterie of scientists and thinkers, including Richard Dawkins, the late Christopher Hitchens, and Lawrence Krauss, have vehemently contended that breakthroughs in modern science have disproven the existence of God, asserting that we must accept that the creation of the universe came out of nothing, that religion is evil, that evolution fully explains the dazzling complexity of life, and more. In this much-needed book, science journalist Amir Aczel profoundly disagrees and conclusively demonstrates that science has not, as yet, provided any definitive proof refuting the existence of God. Why Science Does Not Disprove God is his brilliant and incisive analyses of the theories and findings of such titans as Albert Einstein, Roger Penrose, Alan Guth, and Charles Darwin, all of whose major breakthroughs leave open the possibility— and even the strong likelihood—of a Creator. Bolstering his argument, Aczel lucidly discourses on arcane aspects of physics to reveal how quantum theory, the anthropic principle, the fine-tuned dance of protons and quarks, the existence of anti-matter and the theory of parallel universes, also fail to disprove God.
Download or read book Undeniable written by Bill Nye and published by Macmillan. This book was released on 2014-11-04 with total page 320 pages. Available in PDF, EPUB and Kindle. Book excerpt: From the host of "Bill Nye the Science Guy" comes an impassioned explanation of how the science of our origins is fundamental to our understanding of the nature of science
Download or read book The Origin of Humanity and Evolution written by Andrew Ter Ern Loke and published by Bloomsbury Publishing. This book was released on 2022-06-16 with total page 201 pages. Available in PDF, EPUB and Kindle. Book excerpt: Addressing the intense debate in science and religion in light of evolutionary population genetics, Andrew Ter Ern Loke argues that the theory of evolution as understood by mainstream scientists is compatible with Scripture. Loke asserts that resolving this area of perceived conflict would greatly benefit both scientific and religious communities, and contribute to the spiritual quest of humankind. Whilst affirming that the Bible should be interpreted according to proper hermeneutical principles such as considering the literary genre, literary context, meaning of words, grammatical relationship, and the background and concerns of the ancient authors, this book also assesses the scientific data according to proper mainstream scientific methodology. Having accomplished these tasks, it proposes a model which argues that all humans today have Adam as common ancestor even though this ancestor is not our sole ancestor.
Download or read book Coming to Peace with Science written by Darrel R. Falk and published by InterVarsity Press. This book was released on 2004-04-06 with total page 244 pages. Available in PDF, EPUB and Kindle. Book excerpt: Bringing together a biblically based understanding of creation and the most current research in biology, Darrel R. Falk outlines a new paradigm for relating the claims of science to the truths of Christianity.
Download or read book Did God Use Evolution written by Werner Gitt and published by New Leaf Publishing Group. This book was released on 2006 with total page 146 pages. Available in PDF, EPUB and Kindle. Book excerpt: Drawing from a variety of topics - biology, biblical chronology, and the origin of human language - and showing their relation to one another in solving this question, author Werner Gitt reveals that evolution is not only bad science, it also violates Scripture. Written for the layman, but with a scientific slant, this compelling book devastates Darwinian arguments for the origin of our universe and planet. In helping Christians answer attacks on their faith, Gitt addresses relevant subjects such as: the origin of man, the origin of human language, human behavior, the origin and future of the universe. Book jacket.
Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Download or read book The Language of God written by Francis Collins and published by Simon and Schuster. This book was released on 2008-09-04 with total page 227 pages. Available in PDF, EPUB and Kindle. Book excerpt: Dr Francis S. Collins, head of the Human Genome Project, is one of the world's leading scientists, working at the cutting edge of the study of DNA, the code of life. Yet he is also a man of unshakable faith in God. How does he reconcile the seemingly unreconcilable? In THE LANGUAGE OF GOD he explains his own journey from atheism to faith, and then takes the reader on a stunning tour of modern science to show that physics, chemistry and biology -- indeed, reason itself -- are not incompatible with belief. His book is essential reading for anyone who wonders about the deepest questions of all: why are we here? How did we get here? And what does life mean?
Download or read book The Ultimate Proof of Creation written by Dr. Jason Lisle and published by New Leaf Publishing Group. This book was released on 2009-06-01 with total page 289 pages. Available in PDF, EPUB and Kindle. Book excerpt: It's a bold title: The Ultimate Proof of Creation - But is there such a thing? There are many books that contain seemingly powerful arguments for biblical creation. But is there an ultimate proof of creation? There is an argument for creation that is powerful, conclusive, and has no true rebuttal. As such, it is an irrefutable argument - an "ultimate proof " of the Christian worldview biblical creation. Master the method outlined in the following chapters, and you will be able to defend Christianity against all opposition. Learn how to apply the ultimate proof in dialogues with evolutionists, how to spot logical fallacies, and biblical examples of defending the faith Discover the nature of scientific evidence and its proper role in the origins debate Details how to address theistic evolution, "day age" creationism, and other compromised positions of biblical creationism An exceptional book for pastors, ministry leaders, seminary attendees, and students of religion and philosophy This book is a complete guide to defending the Christian faith, emphasizing the defense of the Genesis account of creation, built on techniques that have been developed over many years and presentations. They are not difficult to apply when you learn how to do it properly. Ready to move beyond the circular arguments? It is time to get to the real heart of the issue and rationally resolve the origins debate. It is time to discover The Ultimate Proof of Creation.
Download or read book Reconciling Genesis Science written by Fred Snowden and published by AuthorHouse. This book was released on 2019-10-10 with total page 103 pages. Available in PDF, EPUB and Kindle. Book excerpt: Evolutionists, Creationists and Intelligent Design theorists have been arguing the questions of the origin of the universe for decades. To the surprise of many, the argument is not simply scientific, Philosophy and point of view often skew the facts. In recent years the battle has escalated, isolating the groups, so the productive communication and genuine debate has become impossible. In this book we look for answers from philosophy, time, life, anthropology, the experts, Columbus & Galileo and the Soul. Can they help us get to the truth?
Download or read book Origins written by Jim Baggott and published by Oxford University Press. This book was released on 2018-06-06 with total page 400 pages. Available in PDF, EPUB and Kindle. Book excerpt: What is life? Where do we come from and how did we evolve? What is the universe and how was it formed? What is the nature of the material world? How does it work? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.
Download or read book Milestones of Science written by Curt Suplee and published by National Geographic Society. This book was released on 2000 with total page 296 pages. Available in PDF, EPUB and Kindle. Book excerpt: Chronicles three thousand years of scientific inquiry, covering such eras as the Classical Era, the Middle Ages, the Revolution, the Age of Reason, and the nineteenth and twentieth centuries.
Download or read book Abusing Science written by Philip Kitcher and published by MIT Press. This book was released on 1983-06-23 with total page 228 pages. Available in PDF, EPUB and Kindle. Book excerpt: Abusing Science is a manual for intellectual self-defense, the most complete available for presenting the case against Creationist pseudo-science. It is also a lucid exposition of the nature and methods of genuine science. The book begins with a concise introduction to evolutionary theory for non-scientists and closes with a rebuttal of the charge that this theory undermines religious and moral values. It will astonish many readers that this case must still be made in the 1980s, but since it must, Philip Kitcher makes it irresistibly and forcefully. Not long ago, a federal court struck down an Arkansas law requiring that "scientific" Creationism be taught in high school science classes. Contemporary Creationists may have lost one legal battle, but their cause continues to thrive. Their efforts are directed not only at state legislatures but at local school boards and textbook publishers. As Kitcher argues in this rigorous but highly readable book, the integrity of science is under attack. The methods of inquiry used in evolutionary biology are those which are used throughout the sciences. Moreover, modern biology is intertwined with other fields of science—physics, chemistry, astronomy, and geology. Creationists hope to persuade the public that education in science should be torn apart to make room for a literal reading of Genesis. Abusing Science refutes the popular complaint that the scientific establishment is dogmatic and intolerant, denying "academic freedom" to the unorthodox. It examines Creationist claims seriously and systematically, one by one, showing clearly just why they are at best misguided, at worst ludicrous.
Download or read book Origins written by J. E. Baggott and published by . This book was released on 2015 with total page 403 pages. Available in PDF, EPUB and Kindle. Book excerpt: What is the nature of the material world? How does it work? What is the universe and how was it formed? What is life? Where do we come from and how did we evolve? How and why do we think? What does it mean to be human? How do we know?There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of spa.
Download or read book Improbable Planet written by Hugh Ross and published by Baker Books. This book was released on 2016-09-06 with total page 358 pages. Available in PDF, EPUB and Kindle. Book excerpt: The Latest Scientific Discoveries Point to an Intentional Creator Most of us remember the basics from science classes about how Earth came to be the only known planet that sustains complex life. But what most people don't know is that the more thoroughly researchers investigate the history of our planet, the more astonishing the story of our existence becomes. The number and complexity of the astronomical, geological, chemical, and biological features recognized as essential to human existence have expanded explosively within the past decade. An understanding of what is required to make possible a large human population and advanced civilizations has raised profound questions about life, our purpose, and our destiny. Are we really just the result of innumerable coincidences? Or is there a more reasonable explanation? This fascinating book helps nonscientists understand the countless miracles that undergird the exquisitely fine-tuned planet we call home--as if Someone had us in mind all along.