Download or read book Creation Life and Hope written by Jiří Moskala and published by Andrews Univ Theological Seminary. This book was released on 2000-01-01 with total page 438 pages. Available in PDF, EPUB and Kindle. Book excerpt: This Festschrift on the occasion of the 60th birthday of Jacques B. Doukhan, D.H.L., Th.D., professor of Hebrew and Old Testament Exegesis at Andrews University, Michigan, contains essays from different fields of scholarship, namely, biblical exegetical studies and articles of Jewish-Christian dialogue. They are arranged according to three main theological emphases of Jacques Doukhan. Creation, Life, and Hope. This publication to honor Dr. Doukhan is a unique collection of 27 essays written by scholars from different universities around the world. Among them are articles byoutstanding world-renowned scholars such as Rolf Rendtorff, Andre LaCocque, William H. Shea, and others. Works in this volume form a notable contribution to the theological discussion on a wide range of vibrant topics.

Download or read book Let Creation Rejoice written by Jonathan A. Moo and published by InterVarsity Press. This book was released on 2014-05-02 with total page 191 pages. Available in PDF, EPUB and Kindle. Book excerpt: The Bible is full of images of God caring for his creation in all its complexity. Yet experts warn us that a so-called perfect storm of factors threatens the future of life on earth. The authors assess the evidence for climate change and other threats that our planet faces in the coming decades while pointing to the hope God offers the world and the people he made.

Download or read book Creation and Hope written by Nicola Hoggard Creegan and published by Wipf and Stock Publishers. This book was released on 2018-04-25 with total page 230 pages. Available in PDF, EPUB and Kindle. Book excerpt: We live in an ecological age. Science in the last few hundred years has given us a picture of nature as blind to the future and mechanical in its workings, even while ecology and physics have made us aware of our interconnectedness and dependency upon the web of life. As we witness a possible sixth great mass-extinction, there is increasing awareness too of the fragility of life on this planet. In such a context, what is the nature of Christian hope? St Paul declares that all of creation "will be set free from its bondage to decay and will obtain the freedom of the glory of the children of God." How are we to imagine this "freedom" when death and decay are essential to biological life as we currently experience it, and when the scientific predictions for life are bleak at best? This book explores these questions, reflecting on how our traditions shape our imagination of the future, and considering how a theology of hope may sustain Christians engaged in conservation initiatives. The essays in this volume are partly in dialogue with the ground-breaking work of Celia Deane-Drummond, and are set in the context of global and local (Aotearoa New Zealand) ecological challenges.

Download or read book All Creation Waits written by Gayle Boss and published by Paraclete Press. This book was released on 2016-10-01 with total page 75 pages. Available in PDF, EPUB and Kindle. Book excerpt: Open a window each day of Advent onto the natural world.

Download or read book Hope in the Age of Climate Change written by Chris Doran and published by Wipf and Stock Publishers. This book was released on 2017-04-27 with total page 258 pages. Available in PDF, EPUB and Kindle. Book excerpt: It is difficult to be hopeful in the midst of daily news about the effects of climate change on people and our planet. While the Christian basis for hope is the resurrection of Jesus, unfortunately far too many American Protestant Christians do not connect this belief with the daily witness of their faith. This book argues that the resurrection proclaims a notion of hope that should be the foundation of a theology of creation care that manifests itself explicitly in the daily lives of believers. Christian hope not only inspires us to do great and courageous things but also serves as a critique of current systems and powers that degrade humans, nonhumans, and the rest of creation and thus cause us to be hopeless. Belief in the resurrection hope should cause us to be a different sort of people. Christians should think, purchase, eat, and act in novel and courageous ways because they are motivated daily by the resurrection of Jesus. This is the only way to be hopeful in the age of climate change.

Download or read book First Light First Life written by Paul Fleischman and published by Henry Holt and Company (BYR). This book was released on 2016-09-20 with total page 40 pages. Available in PDF, EPUB and Kindle. Book excerpt: In this companion to Glass Slipper, Gold Sandal, Newbery Medal winner Paul Fleischman and Julie Paschkis turn to the universal story of creation. In the beginning there was only darkness. . . . There was fire and ice. . . . There was a single drop of milk. Combining elements of the creation story from different traditions, this narrative weaves together one complete picture of how the world began. First Light, First Life is a celebration of the many and varied peoples of the earth, of their commonalities and their differences. It is a celebration of life. Learn more about the creation of First Light, First Life: https://booksaroundthetable.wordpress.com/2016/09/30/first-light-first-life/ http://www.paulfleischman.net/bio.htm#FirstLightArticle

Download or read book Yearnings written by Linda Loewenthal and published by Hachette Books. This book was released on 2006-09-05 with total page 328 pages. Available in PDF, EPUB and Kindle. Book excerpt: "Irwin Kula shows us how to to live our humanness -- the pleasures and the challenges, the messiness and the triumphs -- with a profound acceptance of our desires and foibles and a joy that can only come from understanding." --Deepak Chopra "Yearning. After twenty-three years as a rabbi, I can think of no more defining human experience." Life can be messy and imperfect. We're all looking for answers. And yet, as renowned rabbi Irwin Kula points out, the yearning for answers is no different now than it was in the times that gave rise to Moses, Buddha, and Jesus. Far from being a burden, however, these yearnings can themselves become a path to blessing, prompting questions and insights, resulting in new ways of being and believing. In this, his first book, Rabbi Kula takes us on an excursion into the depths of our desires, applying ancient Jewish tradition to seven of our most wonderful yearnings. Merging ancient wisdom with contemporary insights, Rabbi Kula shows how traditional practices can inform and enrich our own search for meaning. More importantly, he invites us to embrace the messiness and complexities of the human experience in order to fully embrace the endless and glorious project of life.

Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 327 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Download or read book Creation written by Steve Grand and published by Harvard University Press. This book was released on 2001 with total page 246 pages. Available in PDF, EPUB and Kindle. Book excerpt: Working mostly alone, Grand produced Creatures(R), a computer game that allowed players to create living beings complete with brains, genes, and hormonal systems--creatures that would live and breathe and breed in real time. Enormously successful, the game inevitably raises the question: What is artificial life? In this book Grand proposes an answer.

Download or read book Creation Regained written by Albert M. Wolters and published by Wm. B. Eerdmans Publishing. This book was released on 2005-11-10 with total page 166 pages. Available in PDF, EPUB and Kindle. Book excerpt: with a Postcript coauthored by Michael W. Goheen In print for two decades and translated into eight languages, Albert Wolters's classic formulation of an integrated Christian worldview has been revised and expanded to reach new readers beyond the generation that has already benefited from this clear, concise proposal for transcending the false dichotomy between sacred and secular. Wolters begins by defining the nature and scope of a worldview, distinguishing it from philosophy and theology. He then outlines a Reformed analysis of the three basic categories in human history -- creation, fall, and redemption -- arguing that while the fall reaches into every corner of the world, Christians are called to participate in Christ's redemption of all creation. This Twentieth Anniversary edition features a new concluding chapter, coauthored with Michael Goheen, that helpfully places the discussion of worldview in a broader narrative and missional context.

Download or read book Our Last Hope in Creation written by Mohammed Hossain and published by Independently Published. This book was released on 2019-12-04 with total page 70 pages. Available in PDF, EPUB and Kindle. Book excerpt: Truth is the combined fact of life. It divides us between good and evil. At the end truth succeeds. Truth recognizes one power in existence. Truth existed when nothing else existed. There are two types of creation on earth, one that is created from light and the other from fire. Creations of fire will be resolved, and the creations of light will exist infinitely. When this creation is repeated, we will come back to the same reality as of today. In writing this book I was helped by God by several miraculous happenings, including appearances of seven Angels. One Angel confirmed her interest to return, although no time was given, but her intent. We all look for joy and triumph instead of tragedy, and the infinite creation is just moments away in reality. My book explores the understanding of what it takes to be the real creation. Philosophy often involves personal interest and leadership. When recognized it turns into Univision. The facts in this book are taken from my real-life experience, it no doubt opens the all aspects of our dream

Download or read book An Introduction to Biblical Hebrew Syntax written by Bruce K. Waltke and published by Eisenbrauns. This book was released on 1990 with total page 792 pages. Available in PDF, EPUB and Kindle. Book excerpt: Meeting the need for a textbook for classroom use after first year Hebrew grammar, Waltke and O'Connor integrate the results of modern linguistic study of Hebrew and years of experience teaching the subject in this book. In addition to functioning as a teaching grammar, this work will also be widely used for reference and self-guided instruction in Hebrew beyond the first formal year. Extensive discussion and explanation of grammatical points help to sort out points blurred in introductory books. More than 3,500 Biblical Hebrew examples illustrate the points of grammar under discussion. Four indexes (Scripture, Authorities cited, Hebrew words, and Topics) provide ready access to the vast array of information found in the 40 chapters. Destined to become a classic work, this long-awaited book fills a major gap among modern publications on Biblical Hebrew.

Download or read book In the End the Beginning written by Juergen Moltmann and published by SCM Press. This book was released on 2013-01-26 with total page 123 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'In my end is my beginning', wrote T. S. Eliot at the close of his poem East Coker, and that line gave me the title for this book. With it I should like to express the power of the Christian hope, for Christian hope is the power of resurrection from life's failures and defeats. It is the power of the rebirth of life out of the shadows of death. It is the power for the new beginning at the place where guilt has made life impossible. From the Introduction by Jurgen Moltmann In this short doctrine of hope, Jurgen Moltmann examines the personal experiences in life, in which the future is awaited, times when we search for new beginnings and find them. In three parts that correspond to the three beginnings in life: birth, rebirth and resurrection, Moltmann extols the true value of Christian hope that powers new beginnings. Jurgen Moltmann is Emeritus Professor of Systematic Theology at the University of Tubingen, Germany. He is the author of a number of books published by SCM Press, including Theology of Hope, The Crucified God and The Church in the Power of the Spirit.

Download or read book Our Hope written by William Maude and published by BoD – Books on Demand. This book was released on 2023-12-13 with total page 418 pages. Available in PDF, EPUB and Kindle. Book excerpt: Reprint of the original, first published in 1875. The publishing house Anatiposi publishes historical books as reprints. Due to their age, these books may have missing pages or inferior quality. Our aim is to preserve these books and make them available to the public so that they do not get lost.

Download or read book Caring for Creation written by Paul Douglas and published by Baker Books. This book was released on 2016-10-04 with total page 183 pages. Available in PDF, EPUB and Kindle. Book excerpt: Faith-Based Solutions to Caring for the Earth Climate change is a confusing and polarizing issue. It may also prove to be the most daunting challenge of this century because children, the elderly, and the poor will be the first to feel its effects. The issue is all over the news, but what is seldom heard is a conservative, evangelical perspective. Connecting the dots between science and faith, this book explores the climate debate and how Christians can take the lead in caring for God's creation. The authors answer top questions such as "What's really happening?" and "Who can we trust?" and discuss stewarding the earth in light of evangelical values. "Acting on climate change is not about political agendas," they say. "It's about our kids. It's about being a disciple of Jesus Christ." Capping off this empowering book are practical, simple ideas for improving our environment and helping our families and those around us.

Download or read book The Hope of God My Vision of Creation written by Ernest Elton Fenton and published by CreateSpace. This book was released on 2012-05-14 with total page 200 pages. Available in PDF, EPUB and Kindle. Book excerpt: The Hope of God, My Vision of Creation presents Ernest Elton Fenton's concept of what is, and what might be, to those seeking a closer relationship with God. He believes our personal connection with God is unique and requires no interpretation or representation by a third party. He also stresses we have the ability to live a life filled with love by loving not only the Father who created us, but also each other. We must protect the world He provided and use the power, skills, and gifts He gave us to improve, overcome obstacles, and cope with the many challenges we encounter in life. This is the ultimate hope of God, and as an expression of our love, we should communicate with Him through prayer. The author hopes the vision he shares about life, death, hope, prayer, beauty, and love will inspire his readers, enhance their lives, and bring them comfort and peace.

Download or read book A Tear at the Edge of Creation written by Marcelo Gleiser and published by Simon and Schuster. This book was released on 2010-04-06 with total page 306 pages. Available in PDF, EPUB and Kindle. Book excerpt: For millennia, shamans and philosophers, believers and nonbelievers, artists and scientists have tried to make sense of our existence by suggesting that everything is connected, that a mysterious Oneness binds us to everything else. People go to temples, churches, mosques, and synagogues to pray to their divine incarnation of Oneness. Following a surprisingly similar notion, scientists have long asserted that under Nature’s apparent complexity there is a simpler underlying reality. In its modern incarnation, this Theory of Everything would unite the physical laws governing very large bodies (Einstein’s theory of relativity) and those governing tiny ones (quantum mechanics) into a single framework. But despite the brave efforts of many powerful minds, the Theory of Everything remains elusive. It turns out that the universe is not elegant. It is gloriously messy. Overturning more than twenty-five centuries of scientific thought, award-winning physicist Marcelo Gleiser argues that this quest for a Theory of Everything is fundamentally misguided, and he explains the volcanic implications this ideological shift has for humankind. All the evidence points to a scenario in which everything emerges from fundamental imperfections, primordial asymmetries in matter and time, cataclysmic accidents in Earth’s early life, and duplication errors in the genetic code. Imbalance spurs creation. Without asymmetries and imperfections, the universe would be filled with nothing but smooth radiation. A Tear at the Edge of Creation calls for nothing less than a new "humancentrism" to reflect our position in the universal order. All life, but intelligent life in particular, is a rare and precious accident. Our presence here has no meaning outside of itself, but it does have meaning. The unplanned complexity of humankind is all the more beautiful for its improbability. It’s time for science to let go of the old aesthetic that labels perfection beautiful and holds that "beauty is truth." It’s time to look at the evidence without centuries of monotheistic baggage. In this lucid, down-to-earth narrative, Gleiser walks us through the basic and cutting-edge science that fueled his own transformation from unifier to doubter—a fascinating scientific quest that led him to a new understanding of what it is to be human.