Download or read book A Brief History of Creation Science and the Search for the Origin of Life written by Bill Mesler and published by W. W. Norton & Company. This book was released on 2015-12-07 with total page 288 pages. Available in PDF, EPUB and Kindle. Book excerpt: The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.
Download or read book Creation written by Adam Rutherford and published by Penguin. This book was released on 2013-06-13 with total page 288 pages. Available in PDF, EPUB and Kindle. Book excerpt: What is life? Humans have been asking this question for thousands of years. But as technology has advanced and our understanding of biology has deepened, the answer has evolved. For decades, scientists have been exploring the limits of nature by modifying and manipulating DNA, cells and whole organisms to create new ones that could never have existed on their own. In Creation, science writer Adam Rutherford explains how we are now radically exceeding the boundaries of evolution and engineering entirely novel creatures—from goats that produce spider silk in their milk to bacteria that excrete diesel to genetic circuits that identify and destroy cancer cells. As strange as some of these creations may sound, this new, synthetic biology is helping scientists develop radical solutions to some of the world’s most pressing crises—from food shortages to pandemic disease to climate change—and is paving the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? We know that every creature on Earth came from a single cell, sparked into existence four billion years ago. And as we come closer and closer to understanding the ancient root that connects all living things, we may finally be able to achieve a second genesis—the creation of new life where none existed before. Creation takes us on a journey four billion years in the making—from the very first cell to the ground-breaking biological inventions that will shape the future of our planet.
Download or read book Creation written by Adam Rutherford and published by Penguin. This book was released on 2014-05-27 with total page 291 pages. Available in PDF, EPUB and Kindle. Book excerpt: Today’s scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge “synthetic biology” may lead to solutions to some of the world’s most pressing crises and pave the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.
Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Download or read book Origins written by Jim Baggott and published by Oxford University Press. This book was released on 2018-06-07 with total page 432 pages. Available in PDF, EPUB and Kindle. Book excerpt: What is life? Where do we come from and how did we evolve? What is the universe and how was it formed? What is the nature of the material world? How does it work? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.
Download or read book Undeniable written by Bill Nye and published by Macmillan. This book was released on 2014-11-04 with total page 320 pages. Available in PDF, EPUB and Kindle. Book excerpt: From the host of "Bill Nye the Science Guy" comes an impassioned explanation of how the science of our origins is fundamental to our understanding of the nature of science
Download or read book Origins of Life written by Fazale Rana and published by NavPress Publishing Group. This book was released on 2004 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Imagine primordial Earth, a churning cauldron of liquefied rock. Steaming, seething -- a vast desolate wasteland, inhospitable to life. Yet somehow first life appeared. Maybe chemicals in a primordial soup spontaneously spawned a single-celled creature that continued to evolve. Or perhaps a transcendent Creator formed and nurtured the initial life forms. To determine what really happened requires a framework to evaluate the evidence. For the first time in print, Dr. Rana and Dr. Ross present a scientific model for the creation of first life on Earth -- a model based on the Bible. They present testable predictions for this life-origins scenario and for the competing naturalistic scenarios. Which model withstands the rigorous scrutiny of science and the tests of time? The one that does gives insight to a deeper question: Why would the first life forms precede human life by billions of years? Book jacket.
Download or read book In Search of the Origin of Life written by Richard B. Bliss and published by . This book was released on 1979 with total page 51 pages. Available in PDF, EPUB and Kindle. Book excerpt: A textbook which analyzes two theories of the origin of life and presents arguments supporting each one.
Download or read book What is Creation Science written by Henry Morris and published by New Leaf Publishing Group. This book was released on 2018-10-05 with total page 353 pages. Available in PDF, EPUB and Kindle. Book excerpt: Explore the truth of science and faith... and what it means to you! Uncover evidences of Creation in living systems Unravel the questions of Creation and the laws of science Understand the vanishing case for evolution science Many Christians are not aware that many legitimate scientists embrace the Genesis explanation of origins. In What is Creation Science?, two of the most respected members of that group have given us the benefit of their knowledge. The book itself, though technical in places, is remarkably clear, and its focus is on a fair dialogue of the issues. So much so that many thousands of readers have taken to heart Dr. Parker's challenge, to "Think About It!" The creation/evolution question is not an issue that concerns only biologists on the one hand and religious people on the other. In one way or another, the issue permeates every field of academic study and every aspect of national life. It deals with two opposing basic worldviews - two philosophies of origins and destinies, of life and meaning. Consequently, it is (or should be) of special concern to everyone.
Download or read book Science and Creationism written by National Academy of Sciences (U.S.) and published by National Academies Press. This book was released on 1999 with total page 48 pages. Available in PDF, EPUB and Kindle. Book excerpt: This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)
Download or read book The Genesis Quest written by Michael Marshall and published by University of Chicago Press. This book was released on 2021-09-17 with total page 369 pages. Available in PDF, EPUB and Kindle. Book excerpt: "Some have argued that life began in the chemical-rich seas of the early Earth, the famous primordial soup, while others are convinced that life began in strange vents pumping hot water out of the sea floor, where the chemical reactions that sustain living cells could get started. Or perhaps life began in volcanic ponds on land, or in meteorite impact zones, or even in beds of clay. Each idea has attracted staunch believers who promote it with an almost religious fervor. But the story of life's origins is more than this: it is a story that takes in some of the greatest discoveries in modern biology, from cells to DNA, and evolution to life's family tree. This book is the first full history of the scientists who struggled to explain one of the greatest mysteries of all: how and why life began"--
Download or read book Species of Origins written by Karl Giberson and published by Rowman & Littlefield. This book was released on 2002 with total page 292 pages. Available in PDF, EPUB and Kindle. Book excerpt: Human beings need creation stories. Each culture has one, and is defined in part by its unique explanation of how things came to be. Despite the many differences in the creation stories of various cultures, each seems to serve much the same purpose: to answer questions about humanity's role in the larger whole. The people of the United States are no exception. Since the late-19th century, however, the country as a whole has not been able to agree on a common creation story. Part of the discord stems, of course, from the growing cultural and religious diversity of the USA. But Karl W. Giberson and Donald A. Yerxa explain that most of it flows from the reality that Americans rely heavily on two competing, very distinct, worldviews: modern naturalistic science and traditional Judeo-Christian religions. The interplay of these two ideals is at the base of America's ongoing search for its origins. Giberson and Yerxa delve into this search and America's diverse creation myths, myths that the authors dub the species of origins.
Download or read book Four Views on Creation Evolution and Intelligent Design written by Zondervan, and published by Zondervan Academic. This book was released on 2017-11-21 with total page 240 pages. Available in PDF, EPUB and Kindle. Book excerpt: Evolution--or the broader topic of origins--has enormous relevance to how we understand the Christian faith and how we interpret Scripture. Four Views on Creation, Evolution, and Intelligent Design presents the current "state of the conversation" about origins among evangelicals representing four key positions: Young Earth Creationism - Ken Ham (Answers in Genesis) Old Earth (Progressive) Creationism - Hugh Ross (Reasons to Believe) Evolutionary Creation - Deborah B. Haarsma (BioLogos) Intelligent Design - Stephen C. Meyer (The Discovery Institute) The contributors offer their best defense of their position addressing questions such as: What is your position on origins - understood broadly to include the physical universe, life, and human beings in particular? What do you take to be the most persuasive arguments in defense of your position? How do you demarcate and correlate evidence about origins from current science and from divine revelation? What hinges on answering these questions correctly? This book allows each contributor to not only present the case for his or her view, but also to critique and respond to the critiques of the other contributors, allowing you to compare their beliefs in an open forum setting to see where they overlap and where they differ.
Download or read book Creation Facts of Life written by Dr. Gary Parker and published by New Leaf Publishing Group. This book was released on 2006-08-01 with total page 241 pages. Available in PDF, EPUB and Kindle. Book excerpt: What happens when an evolutionary biologist is overwhelmed with scientific evidences of God's plan in nature? After three years of trying to "prove evolution" to skeptical professors in his science department, Gary Parker finally realized that the scientific evidence we see in God's world agrees with what we read in God's Word. In Creation Facts of Life, Dr. Parker respectfully describes the evidences he once used to "preach" evolution - but then he explains how the "rest of the evidence" points away from evolution and toward a perfect world created by God, ruined by man, restored to new life in Christ! In easy-to-follow conversational style, Dr. Parker discusses: DNA and genetics Life Before birth Mutations Adaptations Natural Selection Fossils The Geologic Column The Grand Canyon
Download or read book Origins written by Ariel Adrean Roth and published by Review and Herald Pub Assoc. This book was released on 1998 with total page 388 pages. Available in PDF, EPUB and Kindle. Book excerpt: Are the worlds of science and religion irreconcilable? Has modern science with its theory of evolution disproved the biblical account of the origin of life? If one accepts the biblical account of origins, does one then have to reject science? Scientist and Christian believer Ariel A. Roth argues that taken together, science and religion give us a more complete and sensible understanding of the world around us, our place in it, and our ultimate meaning and fate. Roth examines such topics as the evidence for evolution and creation, the Flood, the strengths and limitations of the scientific method, and the reliability of Scripture. He concludes that the biblical model of a recent creation by God leaves fewer unanswered questions then either science's evolutionary model or any view between the two positions, such as progressive creation or theistic evolution. - Back cover.
Download or read book A Very Short History of Life on Earth written by Henry Gee and published by St. Martin's Press. This book was released on 2021-11-09 with total page 142 pages. Available in PDF, EPUB and Kindle. Book excerpt: The Royal Society's Science Book of the Year "[A]n exuberant romp through evolution, like a modern-day Willy Wonka of genetic space. Gee’s grand tour enthusiastically details the narrative underlying life’s erratic and often whimsical exploration of biological form and function.” —Adrian Woolfson, The Washington Post In the tradition of Richard Dawkins, Bill Bryson, and Simon Winchester—An entertaining and uniquely informed narration of Life's life story. In the beginning, Earth was an inhospitably alien place—in constant chemical flux, covered with churning seas, crafting its landscape through incessant volcanic eruptions. Amid all this tumult and disaster, life began. The earliest living things were no more than membranes stretched across microscopic gaps in rocks, where boiling hot jets of mineral-rich water gushed out from cracks in the ocean floor. Although these membranes were leaky, the environment within them became different from the raging maelstrom beyond. These havens of order slowly refined the generation of energy, using it to form membrane-bound bubbles that were mostly-faithful copies of their parents—a foamy lather of soap-bubble cells standing as tiny clenched fists, defiant against the lifeless world. Life on this planet has continued in much the same way for millennia, adapting to literally every conceivable setback that living organisms could encounter and thriving, from these humblest beginnings to the thrilling and unlikely story of ourselves. In A (Very) Short History of Life on Earth, Henry Gee zips through the last 4.6 billion years with infectious enthusiasm and intellectual rigor. Drawing on the very latest scientific understanding and writing in a clear, accessible style, he tells an enlightening tale of survival and persistence that illuminates the delicate balance within which life has always existed.
